(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Children's Library | Biodiversity Heritage Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "Development of criteria to designate routes for transporting hazardous materials"



rt 

.A3 

On . 

PHWA- 
RD- 

80-105 
c.? 



rt No. FHWA/RD-80/105 




VELOPMENT OF CRITERIA TO DESIGNATE 
ROUTES FOR TRANSPORTING HAZARDOUS MATERIALS 



September 1980 
Final Report 




•»*TES OV * 



Document is available to the public through 
the National Technical Information Service, 
Springfield, Virginia 22161 



Prepared for 

FEDERAL HIGHWAY ADMINISTRATION 
Offices of Research & Development 
Traffic Systems Division 

Washington, D.C. 20590 



/ 



FOREWORD 



This report documents the results of an investigation of hazardous materials 
transport and the development of criteria and a methodology to designate 
highway routes for hazardous materials movements. This report should be 
of primary interest to traffic safety researchers and engineers. 

The research was conducted as part of FCP Project 1A, Traffic Engineering 
Improvements for Safety, as a result of problem statements from the 
Federal Highway Administration's Office of Highway Safety and Bureau of 
Motor Carrier Safety. 

Two copies of this report are being sent to each regional office and 
four copies to each division. Two of the division copies should be sent 
to each State highway agency. 






Charles F. Sch( 

Director, Office of Research 



NOTICE 

This document is disseminated under the sponsorship of the Department of 
Transportation in the interest of information exchange. The United States 
Government assumes no liability for its contents or use thereof. 

The contents of this report reflect the views of Peat, Marwick, Mitchell 
and Company, which is responsible for the facts and accuracy of the data 
presented herein. The contents do not necessarily reflect the official 
views or policy of the Department of Transportation. 

This report does not constitute a standard, specification, or regulation. 



TECHNICAL REPORT STANDARD TITLE PAGE 



1. Report No. 

FHWA/RD-80/105 



2. Government Accession No. 



3. Recipient's Catalog No. 



4. Ti/le and Subtitle 

Development of Criteria to Designate 
Routes for Transporting Hazardous Materials 
Final Report 



5. Report Dote 

—September 1980 



6. Performing Organization Code 



7. Author's) 

Gary L. Urbanek and Edward J. Barber 



8. Performing Organization Report No. 



9. Performing Organization Name and Address 

Peat, Marwick, Mitchell & Co, 
1990 K Street, N.W. 
Washington, D.C. 20006 



10. Work Unit No. 

FCP31A2-586 



11. Contract or Grant No. 

DOT-FH- 11-9595 



12. Sponsoring Agency Name and Address 

Federal Highway Administration 
U.S. Department of Transportation 
Washington, D.C. 20590 



13. Type of Report and Period Covered 

Final Report May 1979 - 
May 1980 



14. Sponsoring Agency Code 

T-0379 



15. Supplementary Notes 



FHWA Contract Manager, D. Robertson, HRS-33 



16. Abstract 

The purpose of this report is to document the results of an investigation 
of hazardous materials transport by truck and to develop criteria to desig- 
nate routes for hazardous materials movements. Section 1 introduces, reviews, 
and summarizes the hazardous materials (HM) routing problem. Section 2 
documents the steps taken — from the development of route selection factors 
to the selection of models used — to predict the probability of an HM accident. 
The documentation consists of: an examination of federal, state, and a 
limited number of local laws and regulations; an indication of which factors 
should be considered for route selection; and the development of a procedure 
to determine the probability of an HM accident on routes considered for the 
transport of HM. Section 3 develops a methodology which can be used to assess 
the consequences of an HM accident; primary factors considered are population 
and property exposure. Section 4 combines the results of Sections 2 and 3 
into a risk assessment methodology which quantitatively indicates routes having 
more or less risk associated with the transport of HM; criteria are also 
presented for designating HM routes. Section 5 presents the results of 
applying the HM risk methodology in two jurisdictions and assesses the utility 
of the methodology. The findings and techniques presented in this report 
are also presented in a shorter, user-oriented implementation guide entitled, 
"Guidelines for Applying Criteria to Designate Routes for Transporting 
Hazardous Materials" (USDOT FHWA Implementation Package FHWA IP 80-20) . 



17. Key Words 

Hazardous Materials Transportation, 
Federal and State 
Hazardous Material Regulations, 
Highway Routing Criteria, Hazardous 
Materials Accidents 



18. Distribution Stotement 

No restrictions. 

This document is available to the public 
through the National Technical Information 
Service, Springfield, Virginia 22161. 



19. Security Classif. (of this report) 

Unclassified 



20. Security Classif. (of this page) 

Unclassified 



21. No. of Pages 

237 



22. Price 



Form DOT F 1700.7 (8-69) 



ACKNOWLEDGMENTS 



This study has drawn on the goodwill and knowledge of many people in the 
hazardous materials transport field. In particular, we would like to thank the 
following individuals who attended our panel meetings: Dan Brame, Traffic 
Engineer, City of Orlando, Florida; Monroe Funk, Principal Planner, Wichita- 
Sedgwick County Metropolitan Area Planning Department, Kansas; Don Fry- 
barger, Director of Safety, Coastal Tank Line Inc., Akron, Ohio; Pete Pedone, 
Puget Sound C.O.G. , Seattle, Washington; Larry Shoudel, Chief of Special 
Vehicle Movement Section, and Mike Bean, Hazardous Materials Section, 
Illinois Department of Transportation; Chief J. T. Alexander, Dallas, Texas 
Fire Department; George Naginey, New York State Department of Transpor- 
tation; Gene Freeman, Hazardous Materials Coordinator, Nashville, Tennes- 
see; Paul Hinds, Vice President for Safety and Personnel, Rogers Cartage, 
Illinois; and Corporal Gary Ashby, Illinois State Police Hazardous Materials 
Enforcement Division. U.S. Government representatives included Donnell 
Morrison (BMCS), John Allen (MTB), Tom Lasseigne (NTSB), and James Twigg 
(BMCS). 

We would also like to acknowledge the advice and direction of Doug Robert- 
son, our contract manager, and Stan Byington, Traffic Systems Division, 
FHWA. Another important contributor to this project was our subcontractor, 
The Institute for Safety Analysis (TISA). 



11 



TABLE OF CONTENTS 



Section Page 



INTRODUCTION TO DETERMINING CRITERIA FOR 

THE ROUTING OF HAZARDOUS MATERIALS 1 

Background 1 

Project Scope 3 

Study Product 4 

Organization of the Report 6 

References 9 



FACTORS CONSIDERED FOR HAZARDOUS MATERIALS 

ROUTE SELECTION 10 

Introduction 10 

Examination of Route Selection Factors 11 

Accident Rate Models 33 
Determining the Probability of a Hazardous Materials 

Accident 35 
Application of Probability Methodology to Washington, 

D.C. , Case Study 44 

Summary 48 

References 53 



SUMMARY OF A HAZARDOUS MATERIALS 

CONSEQUENCES ASSESSMENT METHODOLOGY 57 

Conceptual Framework 57 
Estimating the Potential Consequences of Hazardous 

Material Releases on Highways 69 

Consequence Methodology Applied to Washington, D.C. , 

Case Study 78 

Summary 85 

References 86 



in 



TABLE OF CONTENTS (Continued) 



Section Page 

4 DEVELOPMENT OF A HAZARDOUS MATERIALS RISK 

ASSESSMENT METHODOLOGY FOR EVALUATING 
ALTERNATE ROUTES 87 

Overview of Risk Assessment Methodology 87 
Criteria for Designating Highway Routes for 

Transporting Hazardous Materials 87 
Risk Methodology Applied to Washington, D.C., 

Case Study 91 

Summary 98 

References 99 



RESULTS OF PILOT TESTING CRITERIA FOR 
DESIGNATING HAZARDOUS MATERIALS TRANSPORT 

ROUTES 100 

Pilot Testing Overview 100 

Nashville Pilot Test 101 

Puget Sound Pilot Test 114 

Summary 129 



Appendix 



A DEFINITIONS OF CLASSES OF HAZARDOUS 

MATERIALS 130 



MTB HAZARDOUS MATERIALS ACCIDENT REPORTS 134 



QUANTITY SPILLED VERSUS CONSTANT DOLLAR 

DAMAGES FOR HAZARDOUS MATERIALS INVOLVED 

IN 10 OR MORE HIGHWAY ACCIDENTS 179 



IV 



TABLE OF CONTENTS (Continued) 
Appendix Page 



D WORKSHEET 1: ROADWAY INVENTORIES FOR THE 

FOUR ALTERNATIVE ROUTES IN THE WASHINGTON, 
D.C. , CASE STUDY 186 



E WORKSHEETS 2 AND 3: CONSEQUENCES OF A 

FLAMMABLE LIQUID RELEASE ON THE FOUR 
ALTERNATIVE ROUTES IN THE WASHINGTON, D.C, 
CASE STUDY 200 



CONTROL MEDIUMS FOR SELECTED HAZARDOUS 
MATERIALS FIRES 214 



G WORKSHEET 4: POPULATION RISK CALCULATIONS 

FOR THE FOUR ALTERNATIVE ROUTES IN THE 
WASHINGTON, D.C. , CASE STUDY 221 



H STATISTICAL DESCRIPTORS FOR PREDICTIVE 

EQUATIONS 225 



LIST OF TABLES 

Table Page 

1 Sample Entries in the IBTTA Compendium 19 

2 Variable Roadway Factors 26 

3 Accident Rates and Geometric Features 29 

4 Panel Ranking of Accident Causes 31 

5 Panel Ranking of Roadway Characteristics as 

Accident Causes 32 

6 Models Rejected for Probability Calculations 34 

7 Predictive Parameters for Interstate Equations 40 

8 Rural Highway Predictive Parameters and Adjustment 

Factors 41 

9 Worksheet 1: Roadway Inventory 43 

10 Worksheet 1: Roadway Inventory for Alternative 1 49 

11 Accident Rate and Probability Calculations 50 

12 Distribution of Highway Accidents Involving Hazardous 

Materials, by Class and Commodity 59 

13 Hazardous Materials Activity in Virginia 61 

14 Hazardous Materials Accident Records in Three States 63 

15 Hazardous Materials Classes for Panel Ranking 64 

16 Hazardous Materials Accident Consequences 66 

17 Potential Impact Area by Hazardous Material Placard 

Class 71 

18 Worksheet 2: Population Inventory 74 



VI 



LIST OF TABLES (Continued) 
Table Page 

19 Worksheet 3: Property Inventory 77 

20 Worksheet 2: Washington, D.C. Population Inventory 81 

21 Worksheet 3: Washington, D.C. Property Inventory 84 

22 Highway Structures on the Three Alternatives 93 

23 Worksheet 4: Population Risk Calculations 94 

24 Worksheet 5: Alternatives Comparison 96 

25 Population Risks on Three Alternative Hazardous 

Materials Routes in Washington, D.C. 97 

26 Length Comparisons of Alternate Hazardous Materials 

Routes 104 

27 Intuitively Preferred Routings 106 

28 Summary of Risk Values 111 

29 Alternatives Comparison for Residential Population 127 

30 Alternatives Comparison for Residential Population 

and Employment 127 

31 Medium Used to Control Commodities Most Frequently 

Involved in Accidents 214 

32 Medium Used to Control Those Commodities Deemed Most 

Hazardous in Revised Emergency Response Guide 9/79 218 



VI 1 



LIST OF FIGURES 



Figure 



Page 



1 Representation of a Small City 5 

2 Potential Consequences of Hazardous Materials 

Accidents for Locally Distributed Commodities 7 

3 Potential Consequences of Hazardous Materials Accidents 

for the Transport of Hazardous Materials Through the 

City 8 

4 Alternative Hazardous Materials Routes in Washington, 

D.C. , Case Study 45 

5 Alternative Route Segments 47 

6 Accident Probabilities on Route Segments of Alternatives 

1,2, and 3 51 

7 Quantity of Hazardous Materials Spilled Versus Damages 

Incurred as a Result of the Spill 68 

8 Census Tract Map and Hazardous Materials Impact Zone 

9 Alternative Routes and Associated Impact Zones 79 

10 Population Inventory 83 

11 Nashville, Tennessee, Major Routes 102 

12 Analysis Plan 1 105 

13 Final Analysis Plan 106 

14 Route Segmentation and ADTs 107 

15 Accident Probabilities on Route Segments 109 

16 Population Exposure by Segment 110 



vi u 



LIST OF FIGURES (Continued) 



Figures Page 

17 Location of Fire and Ambulance Stations, and 

Opryland, USA 112 

18 Seattle Metropolitan Area 116 

19 Alternative Hazardous Materials Routings 117 

20 Accident Probabilities on Alternate Through Route 

Segments 119 

21 Accident Probabilities on Alternative Local Route 

Segments - Alternatives 3 and 6 120 

22 Accident Probabilities on Alternative Local Route 

Segments - Alternatives 4 and 5 121 

23 Potential Consequences on Alternative Through Routes 123 

24 Potential Consequences on Alternative Local Routes - 

Alternatives 3 and 6 124 

25 Potential Consequences on Alternative Local Routes - 

Alternatives 4 and 5 «, 125 



IX 



INTRODUCTION TO DETERMINING CRITERIA FOR 
THE ROUTING OF HAZARDOUS MATERIALS 



BACKGROUND 

Several forces and influences have recently combined to increase public 
awareness of hazardous materials transportation. A hazardous material is 
defined in the Hazardous Materials Transportation Act (HMTA) of 1974 as "a 
substance or material in a quantity and form which may pose an unreasonable 
risk to health and safety or property." This definition covers such substances 
as explosives, radioactive materials, liquified petroleum gas (LPG), liqui- 
fied natural gas (LNG), poisons, etiologic agents, and liquid and solid flam- 
mables. Growing concern about the human and environmental consequences 
of unintentional releases of these materials has led to greater government 
and private interest in this problem. 

This mounting governmental, industrial, and private concern about hazard- 
ous shipments over the highways is due to several factors which make this issue 
highly visible: an above average number of serious accidents in recent years; 
widespread questions regarding our technical abilities to control these problems 
(particularly oil spills and poisonous gas releases); and increased public aware- 
ness of the magnitude of the potential problem. 

Several Federal agencies are directly involved in hazardous materials reg- 
ulation. The U.S. Department of Transportation (DOT) administers regula- 
tions through its multi-modal administrations and recently issued a task force 
report on hazardous materials transportation (1).* During the spring of 1979, 
the Senate Committee on Commerce, Science, and Transportation issued a 
review and analysis of the DOT hazardous materials regulatory program (2). 
Both the U.S. Environmental Protection Agency (EPA) and Department of 
Energy (DOE) are also involved with hazardous shipments in the areas of nu- 
clear energy transport and hazardous waste disposal. 

Industry maintains an active interest in this field, through organizations 
such as the American Trucking Association, Inc. (ATA), and contributes to 
the growing national debate over these sensitive policy issues. The American 
Automobile Association Foundation for Traffic Safety, for instance, recently 
published a pamphlet recommending procedures and responses for motorists 
encountering hazardous materials accidents (3). 



^Numbers in parentheses indicate references to be found at the end of the 
section. 



-1- 



V 



DOT has responded to many of these problems under the authority granted 
in the 1974 HMTA. Extensive regulations now cover virtually all aspects of 
packaging, handling, and labeling of hazardous materials during transport. 
One area that has not been carefully regulated is carrier route selection. A 
few general route criteria have been established, as indicated in Section 397.9 
of Title 49 of the Code of Federal Regulations and by the Bureau of Motor Car- 
rier Safety, but no comprehensive authoritative rules currently govern the 
designation of a shipment's path. A Federal Highway Administration (FHWA) 
request for proposals (RFP), entitled "Development of Criteria to Designate 
Routes for Transporting Hazardous Materials," was issued to address this 
particular question. This document is the final report completed in response 
to the contract awarded for the above RFP. 

The FHWA is anxious to develop a uniform policy for hazardous materials 
route designation. A limited number of these substances represent such seri- 
ous health hazards that they should probably be treated on a case-by-case 
basis. On the other hand, many of the risks associated with transporting other 
less dangerous materials can be substantially reduced by thoughtful routing. 
For example, highly vulnerable population centers or environmentally sensi- 
tive areas can be avoided or their potential exposure minimized. A route 
planner who properly understands the potential consequences of releases of 
the different materials will be able to: differentiate between materials that 
can and cannot be contained; identify materials that have localized impacts 
or threaten property more than life; and make other essential decisions. Only 
with such knowledge can planners develop criteria to inflict minimum cost 
on the carrier while providing maximum protection for the public. 

Although DOT has been authorized to govern hazardous materials routing 
practices, it has not yet issued definitive regulations. Both State and local 
governments appear to be waiting for federal initiatives in this area because 
any federal policies adopted will likely preempt local ordinances. A few State 
and local governments have controlled the movements of certain classes of 
materials (e.g., explosives in California and certain nuclear materials in 
New York City), but hazardous materials shipments remain largely unregu- 
lated with respect to route. Bridge, tunnel, and turnpike authorities have 
adopted the most restrictive rules and in several locations prohibit any ex- 
plosives, flammables, or corrosives on their structures. 

The study approach deals with these issues at a national level. One of 
the concerns expressed by local and State governments and shippers was the 
need for the application of consistent regulations in all regions of the country. 
The potential problem posed by locally mandated routing practices could be 
enormous for a shipper trying to comply with such ordinances. On the other 
hand, it is equally unrealistic to expect the Federal Government to designate 
specific routes for local communities. The logical solution, which this study 



-2- 



proposes to develop, is a generalized set of planning criteria that can be used 
by State and local governments but requires interregional consistency. 



PROJECT SCOPE 

The purpose of this project is to develop planning criteria and techniques 
for assessing the relative risks of different routing alternatives for different 
classes of hazardous materials. 

The study addresses hazardous materials shipments that require placard- 
ing. This stems from DOT requirements for placarding that apply to certain 
types or quantities of hazardous materials. 

One of the fundamental study objectives is to develop a risk assignment 
technique for evaluating alternative routes. In this study, risk is defined 
as the multiplicative product of the probability of an accident occurring and 
the consequences of that accident if it does occur: 

Risk = Probability(A) x Consequences(A) 

Thus, procedures that either diminish the likelihood of an accident occurring 
or minimize its consequences also diminish risk. This schema involves two 
major areas of investigation: (1) determine what makes some roadways more 
or less accident prone than others; and (2) identify populations and environ- 
ments whose characteristics and proximity to roadways make them particu- 
larly sensitive to hazardous material releases . 

To meet the dual requirements of national uniformity and local imple- 
mentation, the project team developed routing procedures that can be applied 
at all government levels as well as by the carrier. Factors that have been 
identified as potential risk increasers or decreasers are quantified at the 
national level to the extent possible. However, the planning methodology 
is structured to allow local planners to substitute their parameters if local 
data exist or use informed judgment to better tailor the product to local needs. 
Roadway and traffic factors that affect accident probabilities are based on 
national data, but these values are designed to be default parameters for 
communities lacking superior local information. For example, a community 
may already know which roads have higher accident rates. With this know- 
ledge, the planner is better equipped to determine which roadways should be 
avoided than if he were to rely on nationally derived accident rates for similar 
road types . 



-3- 



The other component of risk, potential consequences, is estimated in a 
similar fashion. A community with specialized response capabilities or unu- 
sual climatic conditions may wish to substitute its estimates of potential conse- 
quences for the nationally generated values. For example, coastal communi- 
ties with prevalent off-shore breezes may assign less weight to the threat of 
concentrated poison gas dispersion than areas with atmospheric inversions or 
prevailing wind patterns that would endanger downwind populations. 

STUDY PRODUCT 

The product of this study may be best understood by examining a hypothe- 
tical example. Figure 1 represents a small city in the midwest that will serve 
as a structural basis for this discussion. To facilitate the discussion, it is 
assumed that no local ordinances affect hazardous materials routing in this 
city. As illustrated, the city uses three hazardous materials: gasoline in the 
filling stations, chlorine at the water works, and anhydrous ammonia for fer- 
tilizer is sold at the grain elevator. In addition, an unknown number of hazar- 
dous materials pass through the city. It is assumed that each of the commo- 
dities used within the city originates east of the city on 1-70. The other 
hazardous commodities have origins equally divided between east and west 
of town. From this description, two routing problems are evident: the local 
distribution of hazardous materials and the transport of hazardous materials 
through the city. 

The shortest distance route for each of the locally distributed commodities 
is simply 1-70 to Main Street and then to the respective destinations within the 
city. However, this route exposes the city's highest value property to the haz- 
ardous materials. On the other hand, this route may have one of the lower 
probabilities of accidents since it is short and intersections (i.e. , exposure) 
with other traffic are minimized. An alternative route with less potential con- 
sequence for the chlorine and fertilizer would be 1-70 to E Avenue, E Avenue 
to the rural road, the rural road to G Avenue, and then to each of the des- 
tinations. This route minimizes consequences but, while it decreases acci- 
dent potential because fewer intersections are encountered, it may increase 
accident potential because the interstate has a greater exposure factor (i.e. , 
volume). Other routes and factors can also be examined, but without quanti- 
fied values it is impossible to determine which of the alternative routes has 
the least risk. 

The through transport of hazardous materials is somewhat different. Both 
US 40 and 1-70 are viable routes, with 1-70 seemingly the quickest and safest. 
However, many cities find that hazardous materials are carried on routes 
such as US 40 because of established habits of drivers, eating locations, or 
other less well-defined reasons. To determine the magnitude of the risk 
differential between the two routes, it is necessary to quantify the components 
of risk associated with the transport of hazardous materials on each route. 

-4- 







City Limits 



PREVAILING WIND 
FROM WEST 



Central Biojma District 



D 



RaidmtW 



FIGURE 1: REPRESENTATION OF A SMALL CITY 



-5- 



This document provides the background needed by the planner or engineer 
to determine the least risk route for transporting hazardous materials , for 
both local distribution and through carriage. Figure 2 describes concep- 
tually the area of influence of the hazardous materials distributed locally, and 
Figure 3 presents the area of influence for the hazardous materials carried 
through the city. In both cases, the shaded areas represent the potential 
impact of a hazardous materials accident at any point along the route. Later 
sections of this report will indicate how to quantify these consequences as 
well as determine the probability of this type of accident occurring anywhere 
along the route . Multiplying the probability of a hazardous materials acci- 
dents times the consequences of the accident produces a risk value. This 
risk value can be computed for each route. Routes having the least risk can 
then be identified. 

This illustrative example has been kept simple for purposes of explanation, 
The sections that follow present the background, development, and method- 
ology used to develop criteria for designating routes for the transport of haz- 
ardous materials . 



ORGANIZATION OF THE REPORT 

Section 2 of this report documents the steps taken from the development 
of route selection factors to the selection of models used to estimate the 
probability of a hazardaus materials accident. Section 3 develops a con- 
sequences methodology which can be used to assess the consequences of ha- 
zardous materials accidents. Section 4 combines the results of Sections 2 
and 3 into a risk assessment methodology, which can be used to indicate 
quantitatively the risk associated with the transport of hazardous materials 
over a pre-defined route. Section 5 presents the results of applying the 
hazardous materials risk methodology in two jurisdictions and assesses the 
utility of the methodology. 



-6- 




City Limro 



PREVAILING WIND 
FROM WEST 



ggj Impact Araa 



Central Butinaa Dirtriei 



Ratidantial 
-_-__ ) Altemittv* Local Rouiaa 



FIGURE 2: POTEiNTIAL CONSEQUENCES OF HAZARDOUS MATERIALS 
ACCIDENTS FOR LOCALLY DISTRIBUTED COMMODITIES 



-7- 




PREVAILING WIND 
FROM WEST 



Central Buiinea District 



□ R ~' 



idcntial 



■**■' Alternative Through Routes 

FIGURE 3 : POTENTIAL CONSEQUENCES OF HAZARDOUS MATERIALS 
ACCIDENTS FOR THE TRANSPORT OF HAZARDOUS 
MATERIALS THROUGH THE CITY 



-8- 



REFERENCES 



1. U.S. Department of Transportation, Report of the Hazardous Materials 
Transportation Task Force , Washington, D.C., September 1978. 

2. Congresional Research Service of the Library of Concress, Hazardous 
Materials Transportation: A Review and Analysis of the Department of 
Transportation Regulatory Program , Committee on Commerce, Science, 
and Transportation, U.S. Senate, Washington, D.C., April 1979. 

3. AAA Foundation for Traffic Safety, Highway Transportation of Hazardous 
Materials: Safety Implications for All Motorists , 8111 Gatehouse Road, 
Falls Church, Virginia, 1979. 



■9- 



2. FACTORS CONSIDERED FOR HAZARDOUS MATERIALS 

ROUTE SELECTION 



INTRODUCTION • 

For purposes of this discussion, the broad range of factors which may in- 
fluence the choice of routes for a hazardous materials movement are divided 
into two groups: mandatory factors and variable factors. 

There are two types of mandatory factors: (1) physical restrictions, and 
(2) legal and regulatory restrictions. Examples of physical restrictions are 
bridge and tunnel, and height and weight restrictions. In the development of 
route selection criteria, physical restrictions are essentially given conditions 
that must be complied with and incorporated into the overall route selection 
process. Legal and regulatory restrictions expressly prohibit or regulate 
the transport of one or more of the classes of hazardous materials. Although 
legal restrictions are mandatory factors, they need not be treated as hard and 
fast restrictions. Rather, they are acknowledged, and the analysis is conducted 
to make sure they are still appropriate. For example, the characteristics of a 
route prohibited from use in the past might be changed by subsequent events 
making the route a potentially viable one for hazardous materials transport. 
The analyst may wish to perform the risk analysis for routes with legal re- 
strictions in order to compare them with the alternatives. If the route with the 
restriction is also the route with the least risk, the community may wish to 
re-examine the restriction from a broader perspective. 

Variable factors are items that affect the route selection decision but 
do not necessarily preclude the use of a route. They are typically influences 
that must be qualified for specific situations. For example, high levels of 
traffic density result in higher accident rates during those periods of in- 
creased activity. Thus, traffic density may become an important criterion 
on certain routes during peak hours but may not be an issue during off-peak 
hours. Traffic density is a variable factor because its relevance is a func- 
tion of conditions at a particular place or point in time. Likewise, popula- 
tion density becomes a variable factor with respect to different classes of 
hazardous materials because different materials present varying levels of 
hazard. 

Substances- -even in small quantities- -that pose serious health threats may 
have different routing requirements than substances with fairly localized im- 
pacts if discharged. Ideally, route selection should strive to find the combi- 
nation of accident probabilities and potential consequences that produces the 
lowest risk. In order to estimate risk, however, it must first be known how 
road and traffic conditions affect accident probabilities and, subsequently, how 
human and environmental conditions can be assigned different consequence 
values. 

-10- 



This section examines the two classes of factors- -mandatory and vari- 
able- -and documents the process for selecting the most important variable 
factors. (By definition, mandatory variables are usually a given in the cri- 
teria selection.) Within the variable factor list, roadway characteristics 
which contribute the most to the likelihood of an accident are identified and, 
in turn, predictive models which use these important factors are presented. 
The factors that influence route selection most strongly from a consequences 
perspective are discussed in detail in Section 3. 



EXAMINATION OF ROUTE SELECTION FACTORS 

Physical Mandatory Factors 

The physical characteristics of the roadway and roadway structures are 
obvious factors in route selection. Clearance heights on overpasses and 
weight limits on bridges are quantifiable factors that will either permit or 
prohibit hazardous material carriers. 

Legal Mandatory Factors 

A legal search was conducted to identify mandatory routing factors at the 
Federal, State, and local levels. Although hazardous materials routing re- 
strictions are not widely used, they exist on numerous bridges, tunnels, and 
privately owned facilities. For example, California has designated certain 
routes as stopping places for trucks carrying explosives. Drivers must com- 
ply with these directives and may only stop at designated places. Some com- 
munities, such as Dallas, Texas, and Washington, D.C., have enacted haz- 
ardous materials routing ordinances to prohibit trucks carrying hazardous 
materials from using certain roadways. The following discussion reviews 
the current status of legal restrictions on hazardous materials movements . 

Federal Laws 

Federal statutes concerning hazardous materials shipment by highway 
have existed since 1908 under the administration of the Interstate Commerce 
Commission (ICC). The Transportation of Explosives Act made it unlawful 
for a common carrier to transport explosives by land, except as provided 
for by ICC safety regulations. Subsequently, this law (35 Stat 554) was 
amended to include other hazardous materials and to extend its coverage 
to shippers, contract carriers, and private carriers. 

In 1967, the ICC's safety regulation function was transferred to the newly 
created Department of Transportation (DOT). The Department of Transporta- 
tion Act (Public Law 89-670) directed the Federal Highway Administration 
(FHWA) to carry out motor carrier safety functions. In order to coordinate 

-11- 



hazardous materials regulations applicable to the various modes of transpor- 
tation, the Secretary of Transportation created the Hazardous Materials Reg- 
ulations Board. 

The most significant and recent legislation in this area is the Hazardous 
Materials Transportation Act (HMTA), Title I of Public Law 93-633, effec- 
tive January 1 , 1975. It delegates broad authority to the Secretary of Trans- 
portation but requires that the Secretary consult with the ICC before issuing 
any regulation concerning the routing of hazardous materials carriers. Sec- 
tion 112 of the HMTA expressly preempts "any requirement of a State or 
political subdivision thereof which is inconsistent with any requirement" of 
the HMTA or regulations issued under its authority. It is significant that 
the law also authorizes the Secretary to waive the preemption if the state 
requirements provide an appropriate level of safety and do not unreasonably 
burden interstate commerce. 

In 1975, the Secretary of Transportation created the Materials Transpor- 
tation Bureau (MTB), made it the lead agency toT)OT's hazardous materials 
safety program, and dissolved the Hazardous Materials Regulations Board. 
The MTB has the authority to issue all hazardous materials regulations for 
DOT although it receives input from modal administrations such as FHVVA 
and the Federal Aviation Administration (1). 

Federal Regulations 

In 1971, a DOT routing regulation was issued under statutes that predate 
HMTA. The regulation, Section 397.9 of Title 49 of the Code of Federal 
Regulations,* applicable to interstate motor carriers states the following: 

397.9 Routes** 

(a) Unless there is no practicable alternative, a motor vehicle which 
contains hazardous materials must be operated over routes which 
do not go through or near heavily populated areas, places where 
crowds are assembled, tunnels, narrow streets, or alleys. Op- 
erating convenience is not a basis for determining whether it is 
practicable to operate a motor vehicle in accordance with this 
paragraph. 



* Hereafter referred to as 49 CFR 397.9. 



**Applicable to hazardous materials carried in quantities such that they are 
governed by placarding laws of 49 CFR 177.823. 



-12- 



(b) Before a motor carrier requires or permits a motor vehicle con- 
taining Class A or Class B explosives to be operated, he must 
prepare a written plan of a route that complies with the rules 
of paragraph (a) of this section and must furnish a copy of the 
written plan to the driver. However, the driver may prepare 
the written plan as agent for the motor carrier when the driver 
begins his trip at a location other than the carrier's terminal. 

Since 49 CFR 397.9 was not issued pursuant to HMTA, that law's express 
preemption provision does not apply to this routing regulation. 

A second regulation, reissued under HMTA in 1976, approves certain 
hazardous materials restrictions imposed by states or localities on the use 
of tunnels (49 CFR 177.810). That section states: 

177.810 Vehicular Tunnels 

Nothing contained in parts 170-189 of this subchapter shall be 
so construed as to nullify or supersede regulations established 
and published under authority of State statute or municipal or- 
dinance regarding the kind, character, or quantity of hazardous 
material permitted by such regulations to be transported through 
any urban vehicular tunnel used for mass transportation. 

Except for these very general regulations, routing of hazardous materials 
carriers has largely been left to States and localities. This philosophy is 
reflected in another Federal motor carrier safety regulation (49 CFR 397.3) 
issued in 1971: 

Every motor vehicle containing hazardous materials must be 
driven and parked in compliance with the laws, ordinances, 
and regulations of the jurisdiction in which it is operated, un- 
less they are at a variance with specific regulations of the 
Department of Transportation which are applicable to the 
operation of that vehicle and which impose a more stringent 
obligation or restraint. 

Since HMTA was enacted in 1975, MTB has not promulgated any new rout- 
ing regulations. On August 17, 1978, MTB announced it was considering a 
national routing regulation for truck transport of radioactive materials (2). 
On January 31, 1980, the MTB published its "Proposed Rulemaking for High- 
way Routing of Radioactive Materials" (3). These MTB activities were largely 
due to an ordinance passed by New York City in 1976, which had the effect 
of banning most commercial shipments of radioactive materials in or through 
the City. The "Notice of Advanced Rulemaking," published in 1978, resulted 



-13- 



in considerable comment from public and private agencies concerned about 
Federal involvement in establishing highway routing requirements for radio- 
active materials. Some of the persons responding were concerned that the 
Federal Government should not encroach on State responsibilities. Others, 
including people from all the cities commenting, stressed that they do not 
want hazardous materials transported through their communities . Motor 
carriers, claiming that they are now hampered by inconsistencies from 
State to State, generally favored a national rule. 

The recently published Proposed Rulemaking states that shipments of 
radioactive materials for which placarding is required must be routed to 
the extent possible, on circumferential interstates around population cen- 
ters . Packages of radioactive materials that do not require placarding com- 
prise the majority of all shipments and would be exempt from this require- 
ment. (These materials pose relatively little threat to population or they 
emit low radiation doses at or near the package surface.) Under the Pro- 
posed Rulemaking, carriers would be required to submit a written routing 
plan, and their movements would be confined to "preferred" highways^ 
unless they needed fuel, repairs, food, lodging, or other necessary steps 
as defined in the Proposed Rulemaking. 

The Nuclear Regulatory Commission (NRC) also has the authority to 
regulate radioactive materials movements in both its regulatory and li- 
censing proceedings. On June 15, 1979, the NRC issued an amendment 
to 10 CFR 73, which is designed to reduce the risk of sabotage from 
nuclear reactors to shipments of spent radioactive fuel transported 
through heavily populated areas. The rule was issued in effective form, 
and public comments were solicited for possible revision after its imple — 
mentation. The rule requires power plant operators to submit to NRC for 
approval, the route(s) carriers will use to haul the spent fuel for dispo- 
sal. 

At the time of the rulemaking, NRC also provided the power plants 
with guidance on how to designate the routes. Carriers must stay at least 
3 miles (4.8 km) away from about 150 cities identified by NRC. If this is 
impossible, other safeguards must be taken, including armed private guards 
or police escorts. The rule is an interim one and may be modified, finalized, 
or rescinded pending the results of ongoing research in the field. NRC has 
received numerous public comments on this rule and is currently analyzing 
them to determine if changes to existing requirements are warranted (4). 



Preferred highways may be designated by States, but the State must use 
the same criteria of high quality roadway design and low population density 
nearby. 

-14- 



The Resource Conservation and Recovery Act (Public Law 94-580) requires 
the Administrator of EPA to promulgate regulations, applicable to transporters 
of hazardous wastes, as may be necessary to protect human health and the 
environment. Standards applicable to transporters of hazardous waste are to 
be consistent with the requirements of HMTA (5). EPA has not issued any 
routing regulations to date . 

Implications of Federal Laws and Regulations 

The Federal laws and regulations regarding the transport of hazardous 
materials suggest criteria to be used in route selection, such as avoiding 
heavily populated areas, narrow streets and alleys, and places where crowds 
assemble. However, Federal guidance does not specify the width of a narrow 
street or alley or define "heavily populated areas" or "places where crowds 
assemble." This guidance, unless more clearly specified, could lead to con- 
siderable inconsistency. For example, a narrow street in Wichita may have 
the same width as a boulevard in Boston, and population density considered 
"light" in Boston may be considered heavy in Wichita. 

In an attempt to overcome potential inconsistency, several Federal agen- 
cies are considering rule making to tighten-up routing criteria for certain 
commodities- -as witnessed by NRC's rule making for spent radioactive fuel 
and MTB's intent to provide routing criteria for radioactive substances. 
However, as discussed below, several states and local communities have 
already enacted legislation to define the Federal guidance more clearly. 

State Regulations 

The States' response to federal regulations concerning routing of hazard- 
ous materials by highway has been mixed. Twenty-six have adopted the 
Federal routing guidance (49 CFR 397.9), and others have dealt with the 
matter in a variety of ways (6). 

At least six States have adopted routing regulations other than 49 CFR 
397.9. For example, Louisiana has regulations for the routing of explosives, 
and New Jersey for radioactive cargo. California has promulgated extensive 
regulations pertaining to the operation of carriers of explosive materials; 
these regulations include routing specifications and the designation of termi- 
nals and locations that may be used as safe parking places (7). 

Eight States have adopted 49 CFR 397.9 and additional routing regulations. 
Washington has pending regulations for the routing of extremely hazardous 
waste. A 1979 law gives the Georgia Department of Transportation authority 
to issue regulations concerning routing, but at this time none has been pro- 
mulgated. 



-15- 



Rhode Island has promulgated extensive rules governing the transportation 
of liquified petroleum gas (LPG) and liquified natural gas (LNG) through the 
state. For example, such regulations were adopted on April 8, 1978, and in- 
cluded the following provisions (8): 

. that all motor carriers transporting LPG or LNG intended for use 
by Rhode Island public utilities seek approval, prior to each ship- 
ment, by filing an application including a certificate that the 
transport vehicle has been inspected and that a Federal Depart- 
ment of Transportation Safety Permit has been obtained; 

. that a copy of the approval be carried in the transport vehicle; 

. that the transportation of LPG and LNG be prohibited from 7 to 9 
a.m. and 4 to 6 p.m. , Monday through Friday; 

. that every LNG and LPG transport vehicle be equipped with a two- 
way radio; 

. that all LPG and LNG vehicles have a sign on the rear bumper 
with 3-inch illuminated letters saying: "Must Stay Back 500 
Feet" (152m); 

. that all LPG and LNG vehicles keep headlights on at all times; 

. that all LPG and LNG vehicles be inspected by the driver and 
appropriate personnel before loading or unloading; and 

. that all LPG and LNG vehicles have lock-on release valve(s). 

National Tank Truck Carriers, Inc. (NTTC) took the State of Rhode Island 
to court alleging that the regulations regarding the signs, the radio, and the 
locks were "inconsistent" with DOT regulations and that the State should have 
applied for a DOT ruling before implementing them. An injunction was issued 
(U.S. District Court, Providence, Rhode Island) against those regulations, 
and the State appealed. The Appeals Court, however, allowed the injunction 
to stand. This decision is particularly important now because many States 
are developing their own hazardous materials regulations, which can differ 
from DOT's and thus cause operational problems. The Appeals Court deci- 
sion essentially affirms the right of a Federal judge to stop State regulations 
even before DOT rules on consistency; and it even allows the courts to make 
a ruling if DOT has made none. 

On December 20, 1979, DOT published an Inconsistency Ruling relating 
to the Rhode Island LPG and LNG regulations. The Materials Transportation 



-16- 



Bureau (MTB) of the DOT found certain provisions of the Rhode Island law 
to be inconsistent with Federal regulations. Under the authority granted in 
HMTA, MTB found that Federal authority preempts the requirements for per- 
mit and permit application, the hours of travel restrictions, written notifi- 
cation of accidents, bumper signs and use of a frengible shank-type lock. The 
other Rhode Island requirements were not found to be inconsistent with Federal 
authority. 

The States' delegation of authority to promulgate and enforce hazardous 
materials routing laws provides another contrast with Federal law. More 
than half the States have two or more agencies with authority to promulgate 
regulations concerning hazardous materials. Twenty States named three or 
more agencies. North Carolina listed six agencies, including DOT,, the Radia- 
tion Protection Commission, and the Pesticide Board. Washington also named 
six, including the State Patrol and the Department of Ecology. Nineteen States 
listed one agency, and three listed none. Transportation departments were 
the agencies with rule making authority named most frequently- -mentioned by 
27 States. State law enforcement departments had regulatory jurisdiction in 
9 States, fire marshalls in 8, and environmental protection agencies in 10. 
Public utility and public service commissions have jurisdiction in 18 States. 
Other agencies listed included motor vehicle bureaus, departments of agricul- 
ture, and the civil defense office. Only two States named agencies that 
specifically address hazardous materials transportation. Illinois has a Haz- 
ardous Materials Section of their Department of Transportation, and Pennsyl- 
vania lists a Hazardous Substance Transportation Board. 

State enforcement of hazardous materials regulations is also complex. 
Twenty States list three or more agencies responsible for enforcing their 
regulations. North Carolina names eight agencies, Kentucky seven, and 
Idaho five. Agencies responsible for enforcement include State police forces, 
fire marshalls, pollution control boards, a civil defense office, public ser- 
vice commissions, and various other State bodies. In all, the States listed 
over 100 agencies that enforce hazardous materials regulations. 

Analysis of State Regulations 

More than half the states have demonstrated a willingness to follow the 
Federal Government's policies for hazardous materials transportation by 
adopting parts of the federal hazardous materials routing criteria. Where 
they have promulgated their own routing rules, they tend to limit them to 
certain substances. The reasons for lack of State initiative in this area 
are not readily apparent. It may be that States do not perceive this as a 
problem area calling for regulation. The fact that to date no comprehen- 
sive or scientific criteria have been developed in this area may play some 
part in State inaction. Some States may believe that their turnpike, tunnel, 

-17- 



and bridge regulations, promulgated by separate authorities, are sufficient. 
Others may be sensitive to the importance of efficient transportation of hazar- 
dous materials to their economies. The complications involved in drafting 
rules that are not in conflict with Federal regulations of hazardous materials 
transportation may also be a deterrent. 

The State-level agencies with power to promulgate or enforce hazardous 
materials transportation regulations range from State police forces to 
departments of transportation and include many different agencies. An impor- 
tant finding for this study is that the staffs of these various agencies have a 
wide range of analytic skills. The risk analysis methodology was developed 
to provide a variety of users with an understandable and low-cost technique 
for evaluating alternative hazardous materials routes. 

Toll Roads , Bridges and Tunnels Regulations 

Shipment of hazardous materials over toll roads, bridges, and tunnels may 
be subject to regulations in addition to state requirements. Many toll roads, 
bridges, and tunnels are governed by separate authorities with power to regu- 
late hazardous materials transport. Most of these authorities were created 
by State legislatures, and their activities are restricted to particular facili- 
ties within that State. State statutes grant most authorities the power to raise 
their own funds. Their ability to issue regulations is also derived from State 
statutes. 

Toll road authorities can enact detailed rules, including those requiring 
permits and insurance for transporting certain materials. As a result, 
these authorities have promulgated more stringent regulations than the State 
and Federal standards for the transport of hazardous materials. Some au- 
thorities are even empowered to ban certain materials from the facilities 
under their control. 

The Federal Government has also created similar authorities to govern 
bi-state facilities and international bridges . These were authorized by Federal 
statute (9) . 

According to a compendium published by the International Bridge, Tunnel 
and Turnpike Association in 1974, there were 20 authorities in 16 States 
governing 48 toll roads, 41 bodies governing 104 bridges, and 9 authorities 
in charge of 1 1 tunnels (10). This compendium also lists the restrictions and 
regulations imposed by those bodies on their transportation facilities for 
shipping radioactive materials (Table 1). A DOT guide also summarizes 
restrictions for specific highways in 21 States, many of which are controlled 
by these independent authorities. This summary provides information on types 
of cargo allowed on specific facilities and conditions or restrictions on its 



-18- 



2 
g 

Q 
Z 

w 



- S 



3 H 


a 

g 


O 


W 

Z 
H 


tf 


Id 


fa 


> 

art 


w 


B 


o 


S 


«< 


S 


0. 


2 


w 




-J 




0. 




9 




< 




ua 









a 


■b 


■ 










e 


















«v i 


1 art 















X >« "0 














K 






41 




3 










41 8 4) 


« 




b 




a 




fa 




EX 


b «u 


1 


01 


4J 


1 






X O 3 


X 




a 




x 




ft) 




a -h 


41 


O 


b 






4rf "Pt i-> a 










b a a 




•W 




41 C 


8-E 


i 


b 


b 


41 






— E a 


u 








a x a 

X O 4a S b 




aW 




a, a 









*J 






X a si «« 


m 










a 






C 4> 


e 


•U 


tw 


E 






80 a. E 


i 




(13 




oox a s 




m 




u « 


Of 




O 




M 






3 6 «j a 




1 




3 4a 41 








U X 


41 


s 




41 








3 b <b 






E 




CO a X 




i 




"0 4* 


41 41 




b 


> 


4J 






b ci a 


n 




a 




be e 






E 


41 X 


<e 


u 










x x o> w 


8 








X 4i 75 








s o 


■ H 




a 


•w 









V U 41 "b 


"3 




a 




b a art "f 




X 




41 


4.1 






O 


b 






- o° E 










E *j a 4i 

art b art B 




o 






to 




a 


a 


M 






41 















"SE 




b 







41 






41 w a oi 


B 




a 




a O E — 73 
> lb S3 g e 




b 




•o e 


u 




— i 


a 






> 41 C. 


O 




U 






m 




s> o 


41 




5) 


"O 








a e * 










8 S fc 8 








B art 


drt «H 


b 


e 


e 


41 






b b 8 41 


fe* 




a 




b o e 




a 




W B 


•N B 


4J 


c 


b 


X 






«=> «J X 

u w f- 











41 u X U IS 




X 




w 


e b 


a 


3 




4i 










ii 




41 41 




ab 




u 


S <rt 


=i 


H 


b 








E 


E 








tS V art 













a 







X 






u C 73 


I 




X 




4a a « U art 




X 




4> 9s 


41 E 




41 




DO 






U 41 • 




00 




X B b art 




00 




CI 


* - 5 


41 


tS 


e 


3 






■B WE 






3 




•o 4i o a u 




3 




73 X 


b U 


£ 












41 >!«H 


e 









a <rt g Pi 









W 4> 




CJ 




«H 


b 






5 01 E — 

6 X S a 




<U 


b 




5) 73 a E ib 

a a o 




b 




6 -e 


- 41 






B 


X 






g 




X 






X 




e « 


•^ 




B 


«J 






— *j a 




E 


b 




art 73 art « art 








•rt 0) 


O b 





ti 










•» 4) "« 


<s 






art art C 8 

a > E a 3 

O 5 4J 73 








-" •o 


art 41 














a «s x E 




4) 


art 










• — i 


B E 


b 


£ 




41 








"3 


a. 


a 






a 




> 


B E 





b 


u 


> 






41 "3 


s 




> 




a b « 8 art 




> 




41 O 




«J 


41 


•H 


a 






b -> « U 


E 


a 


a 




la 4 41 > 


41 


8 




b b 


E w 


u 


b 


i 


b 






a > s 




X 


b 




*■ CMrt 


•rt 


b 




• a 




41 










OP* 




b 


4J 




» 40 b 73 


E 


b 


e 




5 si 


b 


41 


«v 








B b —1 u 


41 








B aw b a B 




ii 




U 4> 




X 


« 









— a. e b 


e 


ib 






art art a b art 


a 


! 


! 


a — 
— a 


8 
►. art 


a 




» 






a b v 


E 





g 




a E E E 

•rt b M art a 


a. 


b c 


00 B 


o 


lb 


B 








u *• E 1 


l- 


so 


fa 




b a x 


a 


art 


u 


SI c 


b b 


s> 





«b 












e 






a a. u a 4a 


X 






aw 3 


41 41 


*B=< 




»s 








•u e 5 U 

8 b O 


a 


art 






b «rt X 


41 


73 




a h 


S b 


AJ 


40 


e 


•8 








a 


^ 




8 b E 4* »rt 








E 


U B 




C 




V 






E oi • 


u 


a 


ft) 




E V 


art 






73 




u 




a 


V 






a. >. u 




a 






73 41 73 









a C 


CI 


41 


S 


E 








« so a 


lb 


o 






a E < E b 




X 




> b 


_j e 


K 


« 


41 


X 






> b b w 








•fi 




> s a a 


00 




^ 


E X 


u 


41 










•a 41 41 B 




b 






a« a 00 


c 






■" a 


O w 




u 


b 


X 






41 "0 B b 


b 


e. 


X 




41 »X B 8 




"o 




u to 


4> 


41 





B 


o 






O B M 41 


41 









V B 41 S 


B 






• "0 


< 73 


X 


b 


* 


b 






8 3 •-' 


4073 


fa 




8 a~ art S 


a 






art 


e 


*-• 


e> 




a. 






o v e 


a 


E 


Cw 




o a <b 4i x 


a 


& a 




•^ b 


4i a 






IM 










e 


8 






•a 6 8 


a 






73 B 


X 


VU 


b 





41 






1,5 — E 

8 01 C 41 


1 




ft) 




73 E 41 « 





a a 




■ 


" E 










b 






S 


fa 




• 3 B b X 


b 


b B 




w >> 






B 


a 






b S aJ X 







■ 




b H E 41 


a. 


a E 




V 


«w •* 


41 




B 








E < aV 


o> 








o a 




9 




art B 


o u 


U 


■0 


O 


B 


41 




<b 3 


X 


4J 


■ 




<b e •- B ss 


b 


a s- 







B 




41 


b 


«j 


C 




O H VI 


hi 


u 


■W 




O i i 41 E X 









a 


B *J 


wu 


b 


C 


E 


C 




X B 




SI 


e 




8 8 


ib 


e c 




• JC 


C b 


*M 




41 


41 


3 




b b v a 


lb 


a. 


i 




B CI rt- b 73 




a S 




« a 


O 


o 


3 


9 


E 


H 




41 


e 


a 




a e 9 i> a 


73 


E 5 




•> a 


— c 




c- 




B. 






» x u e 
aj b o 6 




c 


B> 




art art 00 3 


a 


a, 4i 




w fi,u e 


41 


41 


V 








ii 


art 






4. .J a ba B 


| 


•rt 73 




-a e 


sex 


b x 


X 








u 




X 




art b B 


X -rt 




•J b 


•rt « 


iJ 




3 


-B 


C 




*j s B aW 


wri 


b 


a 




41 73 ^* 




a X 




e a 


3 b 




B) 






1- 




E B B 











E b a 4i 




i 




b x 


»H 


>s 




U 


*> 






a 4i u 


aw 


IM 


a 




a a m e a 


8 


a b 




s u 


41 


X 




K 


> 






3 b — b 


o 




»■ • 




3 X a art 




> E 




tr 


b <b 




►. 41 




<0 




tT aj 




73 


art a 




ir73 a E 


a 


•rt a 




II 


O 


•o 


a 




ii 


c 




E s a 


41 


a 






E a 4i 41 


X 


4i a 




•o x 


41 


41 


•o 


B 


U 


o 




•O a-* a^ B 


X 


g 


o a 




73 m art b — 




V 3 




41 4> 


— b 


3 




C 


S 






41 aj 3 B 


41 


e e 




a -a art a E 
41 «" a. c C 




8 C 




41 


X B 


B 


<p 








4J 




aj — . 00 a 






E 




B 







-« e 


S CI 


m 


c 




«H 


9 




•x a 41 b 


X 




-" ? 




— e a. a * 
b — e a a. 


1 


"d b 




E 


o E 


— 1 





JJ 


"O 


C 




E 03 b fra x 


a 


73 H 




73 














S 












a 








a 




■J 










oe 






•J 






n; 




j 




a 


































P* 














E 




















u 



































-a 


































b 














« 
















73 




O 














a 






ts 










E 




X 














b 






u 






aS 




a 




aw 




41 










e 












41 








9 




e 










e. 






b 










atf 




< 




s 










b 













b b 




b 








9 


e 















X 






« 









Prt 




H 


r> 








u 






au 

3 






X •" 
b B 




> X 




a 
E m 


>, 


73 


n 














< o 






3 a 




a os 




S l"1 


aj 


C 


CM 








SI 






•» 






< O 


CM 




9 in 




8 










E 




sS 


e fa 








o 


X otT 




H K« 


fa 




41 


■ 
art 








B 
3 




CM 


o — 

art IN 






a art 

^ a 


a 


>b a o 




73 B S 


£ 


at 


B 








H 




03 


4J 








aj 


O b art 




B — 


•w 


73 


art 












•ST 


a *8 






a. b 


aj 


c 




8 • 


s 


•vri 


40 








a 


4J 




JJ B 






E g 


41 


IS 0, Jt 




a 5 b 


< 


b 


b 








"O 


CI 


e 


b a 






B 


4. Ob 






■ 


«rt 








a 


41 


n 


— 






3 73 


3 


-< 




eo-rt o 






> 








B 


b 


00 


c >> 






H 3 


X 


b a > 




73 41 "rt 




IK 










a 


u 


-^ 


a iri b 






b 


U 


73 




art a 




« 










u 


ta x 


cm c 






• a. 


a 


X 8 » 




b b at 




B 


a— a 












V 


a »■» s 








B 


4i «s b a 




b to a 






— i 41 








•D 


b 




b 0B 






b a. 


tD 


s a H z 




z 




41 41 










B 


41 


X 


H • 






a c 


ffi 


< B 




X X 




Jt U 


K b 








e 


AJ 




K « 






a c 


X 


b 73 - 




00 00 » 




e art 


e 










a 




•0 O b 






3 O 




41 a — Jt 




3 3 i 




41 b 


■fi 








*i 


3 


•j 


E B O 






X *"1 




b a-j u b 




0b 




CU 










«j 




c _ E 






u 


g 







b b 




fl) • 













< 











e a 


a. S 3 s- 




3- 




■ a 


O 41 








b 




b 


>> O b 






a aw 


41 


a 




X X 




u a 


a 








4J 




u 


b •— 






B art 


a 


a Z a S 




art art * 




6 


* a 
Ct. CJ 








£ 


m 


£ 


a a a 

X Pa B 






8 3 

£ to 



m 


X CO 
H O Z 




b b a 

H (rt Z 




41 

e 
c 


































■8 










■rt 
























c 










41 






















K 


■ 










E 












B 










•w 












E 






41 






md 








a 


44 


41 










3 






B 






t) 








E — 


•M 


00 










H 






E 






E 








B a 


••=- 


■o 
















3 






e 








3 E 


u 


art 
















H 






3 








H E 


fB 


b 










wb 












H 










k. 


a 

a 

B 

41 

.* 

a 

41 

a. 
a 

a 












H 

*b 

s 

E 
O 

e 
E 
b 

41 






b 


X 
b 

41 

b 
O 
E 

art 
U 






b 

a 

to 
i 

e 
a 




a a 

E e 

E E 
3 3 
H H 

73 E 

B — 
B 

•rt O 




a e 

b 5 

41 

8 41 
B 73 
l —* 

B X 
is i 

art B 

.* s 
o a 




41 










U 






art 










•rt B 






X 

5 










E 
f 






B 






a 
U 




-rt 

= J 




B O- 



LU 

U 
O 



-19- 



passage (11). For example, in California the carrier must have enough insur- 
ance to cover potential damages to State facilities before crossing the Benicia 
Martinez Bridge on 1-680, and on the San Francisco-Oakland Bay Bridge 
specific flammable liquids are prohibited. Restrictions on New York City's 
Goethals Bridge allow any type of hazardous cargo across but only at certain 
periods of the day. 

The regulations governing transport of hazardous materials through tun- 
nels are equally diverse. The Memorial Tunnel on the West Virginia Turn- 
pike allows all hazardous cargos to pass through without restrictions; while 
the Eisenhower Memorial Tunnel in 1-70 west of Idaho Springs, Colorado, 
allows no hazardous materials unless the Loveland pass is closed- -at which 
time they are allowed through under strict, controlled conditions. Between 
the spectrum of no control and total prohibition are such regulations as: the 
Houston, Texas Washburn Tunnel, which allows only radioactive materials; 
the Chesapeake Bay Bridge Tunnel, which allows small quantities of com- 
pressed gas and combustibles; and Virginia's Big Walker Mountain Tunnel, 
which allows only compressed gas, combustibles, and poisons. Other tunnel, 
bridge, and roadway authorities have still different variations of these regu- 
lations. However, the above examples serve to emphasize that these author- 
ities are generally somewhat more restrictive than State or Federal regulat- 
ing bodies. 

Implications of Toll Roads , Bridges , and Tunnels Regulation 

Toll road, bridge, and tunnel authorities have been able to enact more 
detailed and stringent regulations for hazardous materials transportation than 
Federal and State lawmakers. This may result from basic structural dif- 
ferences between an independent highway facility authority and a government 
body. Due to their degree of independence, facility authorities have few of 
the political considerations that can complicate and delay governmental law 
or rule making processes. Toll facility authorities have no direct constituen- 
cies to serve and thus operate in a more insulated regulatory environment. 

Facility authorities also have a necessarily limited jurisdiction, reliev- 
ing them of the responsibility of creating comprehensive regulations. Re- 
quired only to regulate hazardous materials transportation on a limited num- 
ber of facilities, such authorities can generate rules conforming to the specific 
needs of these facilities. On the other hand, government bodies must consider 
vast numbers of facilities varying widely in characteristics, and they also have 
responsibility for businesses and consumers who rely on efficient commercial 
shipment. 



-20- 



The limited jurisdiction of facility authorities makes it easier for them 
to enforce regulations . The nature of toll roads , bridges , and tunnels is 
such that they have limited and controlled access points routinely staffed 
and patrolled. 

Toll roads, bridges, and tunnels are often financed privately from bond 
sales and are thus major private investments needing protection. Possible 
interruption of service or extensive damages caused by hazardous materials 
accidents, and resulting financial losses provide increased incentive for 
stringent regulations. Another factor is insurance considerations for these 
facilities. 

An examination of the specific rules of these authorities suggests that 
while the respective authorities do not agree on specific criteria for- rout- 
ing hazardous materials, they have nevertheless explicitly or implicitly em- 
phasized certain criteria. Explicit criteria include the insurance require- 
ments of the carrier and the time of day rules. The insurance requirement 
assures the authority that the carrier can afford repair costs if a mishap 
occurs. Allowing the hazardous materials transport only at a certain time 
of day or after other traffic is stopped shows direct concern with hazardous 
materials vehicle exposure to other vehicles. 

Implicit criteria may include, for example, prohibiting flammables- -which 
might suggest a lack of proper response equipment for a tunnel or structural 
concern for a bridge. Allowing only specific quantities of material might sug- 
gest that the authorities have calculated the probable consequences of certain 
hazardous materials and are convinced that their facility can withstand a 
potential mishap involving the specified quantity of material. The diversity 
of regulations suggests that risk may be perceived differently or that the 
communities served by the facility are economically dependent on the trans- 
port of the material. Regardless of the reasoning behind these diverse rules, 
one factor is clear: any guidance provided in this project must deal with the 
type and amount of hazardous material and be flexible enough to be used by 
a wide range of facility operators. 

Local Ordinances and Regulations 

In addition to the examination of Federal and State statutes and the applic 
able regulations, nine cities were selected randomly to determine what types 
of ordinances and restrictions might be encountered at the local level. The 
cities were chosen on the basis of their geography, size, interstate routes 
within their territorial boundaries, and previous knowledge of regulations per- 
taining to hazardous materials accidents. In accordance with these criteria, 
cognizant agencies were contacted in Baltimore, Chicago, Dallas, Los 
Angeles, New York City, Portland, Providence, Salt Lake City, and Savannah. 



-21- 



Baltimore (12) 

The city of Baltimore is empowered to enact laws and regulations relating 
to the transportation of hazardous materials • Furthermore , the Commissioner 
of Transit and Traffic in Baltimore has the power to establish routing restric- 
tions. All carriers of hazardous materials must comply with the existing 
truck routes designated in the city. Baltimore once had specific restrictions 
concerning the roads hazardous materials carriers may use , but residents of 
those streets objected to this form of routing. As a result, the city now re- 
quires a permit only for carriers of explosives. When the Baltimore City 
police force serves as an escort to these carriers, it tries to keep hazardous 

materials carriers away from the vicinity of hospitals, retirement homes, 
and other quiet facilities. 

Chicago (13) 

The Bureau of Street Traffic in Chicago regulates intercity movement of 
hazardous materials in Chicago. It tries to follow State and Federal regula- 
tions based on the theory that uniformity of hazardous materials laws and 
regulations is a desirable goal. The Illinois Department of Transportation 
has designated truck routes through Chicago. According to Traffic Regulations 
of the city of Chicago, Chapter 27, Municipal Code (27-334-341), trucks can 
use the closest means of getting to a facility. But the Bureau of Street Traf- 
fic has indicated its hope that carriers with hazardous materials would cir- 
cumvent the city of Chicago whenever feasible. 

Dallas (14) 

A major rail transportation accident involving hazardous materials, re- 
sulting in $5 million of property damage in Dallas, encouraged the formation 
of a committee headed by the Dallas Fire Department. The committee's 
duties were to investigate the practices of hazardous materials transporta- 
tion and make subsequent recommendations. During the study, the committee 
discovered what they interpreted as a dearth of regulations in the area of 
hazardous materials transportation. 

Pursuant to the Advisory Committee's recommendations, Dallas passed 
Ordinance No. 1594, empowering the Fire Department and other Dallas peace 
officers to enforce the following regulations: 

. Hazardous materials carriers are prohibited frdm traveling: 

. on any road that has to be excavated below ground level 

(cuts); 




. on high overheads; and 

. in tunnels . 

. Otherwise, carriers of hazardous materials must stay on the inter- 
state highways and cannot enter the city limits unless making a 
local delivery. 

Los Angeles (15) 

Los Angeles currently has no specific routing restrictions for hazardous 
materials. Although it is in the process of establishing regulations restricting 
the movement of hazardous materials within the city, certain weight restrictions 
apply to all trucks whether or not they are carrying hazardous materials . Com- 
mercial streets are favored over residential streets for truck routes, and 
restrictions also apply in terms of times of day and traffic situations. 

New York (16) 

The New York City Department of Transportation has promulgated only 
one regulation in the area of transportation of hazardous materials. Subsec- 
tion 158 of Article 15 of the New York City Traffic Regulations establishes 
certain route requirements for carriers of radioactive materials. 

158. Transportation of Radioactive Materials 

Shipments of radioactive materials meeting or exceeding the 
specifications of "large quantities" and/or "fissile Class III" 
as specified by the Interstate Commerce Commission and the 
Atomic Energy Commission, shall follow the same truck routes 
designated for vehicles having an overall length of 33 feet or 
more, in Article 16 of the New York City Traffic Regulations. 

In addition to the Department of Transportation's regulation, the City's 
Department of Health has promulgated one of the most significant local reg- 
ulations in the field of hazardous materials transportation. Section 175.111 
became effective on January 15, 1976, and effectively forbids the transpor- 
tation of most nuclear fuel cycle materials in or through the city. The New 
York law is an interdiction of truck traffic in radioactive materials from 
facilities on Long Island, New York, through the city to destinations in other 
States. Section 175.111 led to a denial of Injunctive Relief in the Federal 
District Court for the Southern District of New York and an inconsistency 
ruling by DOT as to whether Section 175.111 is inconsistent with, and thus 
pre-empted by, the HMTA or regulations issued thereunder (17). In the 
injunction action, the Federal Government argued that Section 175.111 was 



-23- 



preempted under the Supremacy Clause and the Commerce Clause of the 
United States Constitution, and by the Atomic Energy Act of 1954 and the 
regulations issued under that Act. 

On April 4, 1978, DOT held that Section 175.111 was not inconsistent 
with the requirements contained in the text of the HMTA. Express preemption 
under Section 112 of the HMTA occurs upon the existence of mutually inconsis- 
tent HMTA and State or local requirements . Thus , DOT held that Section 
175.111 of the New York Health Code was valid and enforceable. 

Portland (18) 

Portland has no routing regulations but is considering studying the trans- 
portation of hazardous materials . No structured program currently exists in 
Portland. 

Providence (19) 

The city of Providence has not promulgated any regulations in the area of 
hazardous materials transportation. 

Salt Lake City (20) 

Salt Lake City had a law that restricted the carriers of corrosives or 
flammable substances to certain streets in the city. Furthermore, the law 
applied 49 CFR 397.9 to Salt Lake City. However, the courts in Utah ruled 
that these city ordinances were preempted by the State. The court held that 
the State is supposed to set hazardous materials routes through the cities. 
As of June 1979, the State of Utah has not established specific routing guide- 
lines for Salt Lake City. 

Savannah (21) 

The city of Savannah has not enacted any law or regulation on the subject 
of hazardous materials transportation. Presently, the only enforceable rout- 
ing restrictions in Savannah are those already established for all trucks. 
These restrictions apply to residential streets and streets in the historical 
areas of Savannah. 

Analysis of Local Regulations 

Local regulation of hazardous materials transportation varies greatly in 
substance and extent. City governments face jurisdictional questions, partic- 
ularly when dealing with State or interstate highways . One city contacted has 
no jurisdiction over interstate highways within its boundaries. Another city's 



-24- 



regulations were struck down after a court ruled that routing regulations are a 
State function. Such jurisdictional questions will be decided by the form of 
State constitutions, laws, and judicial interpretation. 

Only two of the nine cities studied have enacted their own routing restric- 
tions. NRC's new regulation will probably affect New York's ban on radio- 
active materials transportation. The Dallas regulations, enacted after a major 
rail accident, are strict but general in nature. Some cities are empowered to 
issue regulations but have not done so up to now. 

Although city governments are becoming increasingly aware of the need 
for hazardous materials routing guidelines, the relationships of cities to the 
Federal and State governments may complicate the regulation of hazardous 
materials routing at this level. Finally, from the local perspective, it would 
seem that there are many regulations; in fact, an examination of the substance 
of many of the regulations has shown just the opposite. Also, Baltimore's 
experience with moving a hazardous materials route after hearing citizens' 
objections suggests the need for citizen input in the decision process regarding 
hazardous materials route selection. 

Variable Factors 

One of the central themes of this study was to identify and prioritize the 
numerous variable factors that can affect hazardous materials route selec- 
tion. Table 2 presents a list of potential variable routing factors that apply 
to highway and traffic conditions . 

Unfortunately, highway transport of hazardous materials has only recently 
become the subject of heightened public concern, and thus the body of prior 
research in this field is limited. Based on existing research, there is no 
uniform or reliable method to determine which of the factors in Table 2 are 
the most important roadway factors for hazardous materials route selection. 
The study addresses this inadequacy by presenting a process for determin- 
ing which of the variable factors should be included as route selection criteria. 
In addition to variable roadway factors that might contribute to the likelihood 
of an accident, routes should be designated on the basis of what the potential 
consequences would be if there were an accident. The concept of consequence 
variables and their priorities will be explored fully in Section 3 . The remain- 
der of Section 2 will present an analysis of roadway variable factors and their 
role in the route selection process. 

The fundamental question associated with this aspect of the study is: which 
roadways are characterized by above-average hazardous materials accident 
rates ? This question may be addressed by reviewing data already collected 



-25- 



TABLE 2 
VARIABLE ROADWAY FACTORS 



Traffic Conditions 


Road Conditions 


Hazardous Materials Transport 


ADT 


Grade, curvature, 
access, speed 


Trip origin and destination 


Traffic density by 


limit, shoulder 


Type and quantity of hazardous 


time of day/day 


width 


materials (including packaging, 


of week 




magnitude, and nature of potential 




Conditions under 


threat to life and property) 


Accident and inci- 


adverse weather 




dent rates 


conditions: icing, 
fog, wet 


Vehicle type used to transport 


Average travel 




Driver perceptions (including 


speeds 




ease of use of a route; benefits/ 
disbenefits such as time costs; 


Traffic mix 


Street width 


turns, circuity, and signing) 


Speed variance 








Pavement condition 


Economics of routing 


Stops at signalized 




(including equipment utiliza- 


intersections 


Number of inter- 


tion", mileage, travel time, 




sections 


costs) 




Traffic controls 






Traffic operation 






(1-way, 2-way) 






Parking 





-26- 



for a locale or by using the methodology presented below which relies on pre- 
dictive models and accident data collected at the national level. In all cases, 
the study recommends using local data first and then nationally derived infor- 
mation as default parameters for communities lacking the required informa- 
tion. For communities that do not know the accident rates on their roadways, 
the study searched the literature to determine which roadway features are 
most likely to cause an accident. On the basis of this information the hazar- 
dous materials route could be designated to avoid particularly dangerous road- 
ways and thereby reduce accident probabilities. The approach used to identify 
these dangerous roadway features and geometries was, first, to review the 
literature and, second, to convene a panel meeting of knowledgeable persons 
and solicit their opinions. The findings from these two tasks were subsequently 
used to select predictive models for forecasting the likelihood of an accident 
given certain highway conditions . Each step of the chronology is discussed 
in detail below. 

Literature Review 

A limited amount of work has been done to date relating the probability 
of a truck accident to the traffic environment or roadway design. Since the 
focus of this task was to identify factors that can be realistically controlled 
(or avoided), studies identifying drivers, vehicles, or the weather as causes 
were not useful. Only two sources were found which analyzed truck accidents 
and roadway geometries (22) (23). One (22) was of little value because only 
a few specific accident types were investigated, and it was not possible to 
generalize these findings to a wider class of accidents. The other study (23) 
was also of limited value, as the report is in draft form and its specific find- 
ings are unavailable. 

Because of the lack of information on truck accidents and their roadway- 
related causes, it was necessary to rely on accident data that had been col- 
lected for both automobiles and trucks (not stratified by vehicle type). Al- 
though this approach has certain obvious limitations, a lack of data on the 
causes of hazardous materials accidents led the contractor to make the as- 
sumption that roadway and traffic conditions that result in above average 
accident rates for all vehicles pose a similar threat for trucks alone. 

The literature review revealed two general areas of investigation in acci- 
dent rate research. One centered around primary observations on specific 
roadway types and calculations of the number of accidents per million vehicle- 
miles on those segments. The observations were made on segments with 
similar geometries (e.g. , curved sections of rural highways) and were often 
stratified by ADT levels. The value of this technique is its straightforward 
and understandable methodology; the disadvantage is the limited number of 
simultaneous influences which can be considered. Most of the explanatory 



-27- 



relationships were essentially bivariate, i.e., accident rates as a function 
of one roadway characteristic (24) (25) (26). Table 3 presents representative 
findings on accident rates that can be associated with specific roadway geo- 
metries for three roadway types. Unfortunately, this information did not 
suit the needs of the study as there was no acceptable way to combine these 
accident rates for roadways possessing numerous characteristics within the 
same segment. 

The other body of research in accident causation is the specification and 
calibration of multi-variate regression models. These models attempt to 
predict accident rates on the basis of several roadway and traffic conditions. 
Essentially, they are based on observations of segments with several features. 
By combining the observed accident rates which occurred under varying condi- 
tions, the model assigns a weight to the influence of each characteristic. Al- 
though the reliability and precision of these models is subject to debate, they 
offer the only method for comprehensive accident analysis. Therefore, acci- 
dent rate predictive models that may be used in the probability methodology are 
discussed in detail below. The findings from the panel meeting were used to 
help identify which variables in Table 2 were most important and should be 
included in the models. 

Panel Ranking of Factors 

To determine the relative importance of factors that might influence the 
selection of hazardous materials routes, a multi-disciplinary panel was con- 
vened and panelists were asked to make paired comparisons among the range 
of possible route selection factors in order to determine which are most impor- 
tant. Factors were weighted for several hazardous materials topics, including: 
hazardous materials accident causes, carrier compliance with hazardous 
materials routings, and roadway characteristics as hazardous materials 
accident causes. The 13 panel members included representatives from Fed- 
eral, State and Local governments and the motor-carrier industry. Panel 
members were chosen to provide a wide range of perspectives as well as to 
represent the various interests that might be affected by hazardous materials 
routing decisions. Panel members who work at the City level included a Fire 
Chief, a Civil Defense and Emergency Preparedness representative, a traffic 
engineer, and a community planner. Two of the State-level panel members 
were responsible for hazardous materials transportation within their respec- 
tive states. One panel member is the safety director for a major hazardous 
materials tank truck carrier company. Federal representatives were drawn 
from the MTB, Bureau of Motor Carrier Safety (BMCS), and the National 
Transportation Safety Board (NTSB). Results from the accident cause ranking 
exercises are presented below. 



-28- 



TABLE 3 



ACCIDENT RATES AND GEOMETRIC FEATURES 
(ACCIDENTS/MILLION VEHICLE— MILES) 



TRAFFIC * ROAPWAV CHARACTERISTICS 
CHARACTERISTIC STRATIFICATION 



INTERSTATEffREEWAYS 



RURAL MMHWAY8 



URBAN ARTERIAL8 



source «2D 



ACT 
WWW 
MJ 
2444 
44-74 
I4-1S4 

iwms4 



u±a_ 



M.0414 

szo-ru 

714 



1.12 

42 
44 
41 
41 
M 



UlbwW-U 



2-1 



141 
144 
144 
14* 
14* 
244 
147 



2,12 
141 
2.1* 
2.71 



-±Uffi_ 



14 
2.11 
241 
241 



_tya 



2X0 
1.72 
248 
241 

2.4* 



24. 
242 



M£L 



746 
•42 



441 
44* 
S44 
•.It 



2-1 







41-14 
141-24 
14144 
141-114 
1141 4M 



TJ3" 

141 
2.14 
2.71 

140 



44JUJ 



1.41 
141 
242 
247 



444P) 



»UU) 



4-UP) 
-14T 



241 
4.70 
7.12 
1242 



241 
141 
•41 



1.71 
Ml 



24. 



SOURCE: <2S) 




41-14 
141-104 
1041-204 
1041-404 
4041404 
•041-110 



141 
141 
240 
1.71 
141 



_±ug_ 



241 

241 
2.14 



J2£L 



142 
141 
241 



444U) 



4-UP) 



142 
(.14 
12.11 



4.11 
1.74 
1.11 



244 
•41 
141 
141 

7.10 
1041 



1» 
1*4* 



•ounce: am 



id 

Cumttn 



044 
1-14 



10 

•OUNCE: 0«) 



24. 


4-UU) 


**m 


14 


14 


14 


24 


24 


24 


24 


14 


1.1 


14 


14 


1.7 



2 
14 



•OUNCE: (2» 



1 
144* 
4441 
•44* 

27 

SOURCE: CM) 



24. 


44JU) 


**m 


24 


2.7 


24 


24 


24 


24 


24 


24 


24 


1.1 


24 


14 


24 


24 


14 


1.7 


24 


14 



3P 1 



mi. 



SOURCE: OH 



jnopi 



_lk_ 



"ft- 



-2±_ 



-&T 



tHo- 



Cun*thn P m i l l l Qmt* 
Down 
24 



< 
1«4* 



Up 
2 24 



1.11 
242 



NOTE: Alt F t— «yl 
SOURCE: CM) 



Cunotwo 



0-24 
144 
•44 

>10 

NOTE: 2-L Onty 
SOURCE: (24) 



r*#res>*rt Qrcds) 



< 


> 


2 


1 


14 


24 


24 


24 


24 


24 


14 


14 



-29- 



Accident Causes 

The panel ranked hazardous materials driver error and environmental con- 
ditions (weather, lighting, etc.) as the two most important causes of hazard- 
ous materials accidents. Some panelists also felt that "other motorists" were 
more important than the group ranking of fourth out of five. Roadway charac- 
teristics ranked third, and subsequent discussions indicated that this factor 
was relatively unimportant in the overall context of hazardous materials acci- 
dent causes (see Table 4). Of the three major factors that might be responsi- 
ble for an accident- -driver, vehicle, or operating conditions- -the driver is 
widely recognized in the literature as the most frequent single reason. How- 
ever, this research effort only addresses the roadway operating conditions. 
Other federal agencies are or will be addressing these other aspects. The 
panel's consensus that roadway characteristics were not major accident causes 
supports the previous statement that in the overall context of accident analysis, 
the scope of this project addressed only a portion of the total hazardous 
material transport issue. 

It is noteworthy that the two factors strongly influenced by government- - 
roadway design and vehicle performance (through safety inspections)- -rank 
low as explanatory variables for hazardous materials accidents. Two possible 
explanations are: (1) that government has been successful in designing safe 
roads and prohibiting unsafe vehicles from operating, and (2) that human be- 
havior is so variable that driver performance is the overriding consideration 
and roadway and vehicle characteristics are insignificant by comparison. 

Another objective of this study was to attempt to identify components of the 
hazardous materials transport system where small improvements might pro- 
duce large safety gains. Because the panel rated roadway design relatively 
unimportant as an accident cause, routing criteria based principally on road- 
way characteristics may not significantly affect accident rates. If routing 
regulations are unlikely to greatly reduce accident probabilities, attention 
should be focused on ways to anticipate and respond'to accidental hazardous 
materials releases. This finding implies that more weight should be placed 
on the "consequences" than the "probability" component of the risk equation. 

Roadway Characteristics 

Roadway characteristics that panel members considered most likely to cause 
a hazardous materials accident were typically those factors which required 
vehicle maneuverability and short braking distances. Specifically, roadways 
characterized by intersections, frequent stops, businesses, turns, high traf- 
fic density, and high travel speeds were felt to be the most dangerous. Table 
5 presents the panel's roadway feature rankings. 



-30- 



TABLE 4 
PANEL RANKING OF ACCIDENT CAUSES 



FACTOR 


RANK 


Hazardous materials driver error 


1 


Environment (weather, lighting) 


2 


Roadway design and characteristics 


3 


Other motorist error 


4 


Hazardous materials vehicle performance 


5 



NOTE: The factors ware ranked according to the likelihood of their contributing to a hazardous materials 
motor carrier accident; the number 1 rank is for the most Important factor. 



TABLES 
PANEL RANKING OF ROADWAY CHARACTERISTICS AS ACCIDENT CAUSES 



FACTOR 


RANK 


All 

Panel 

Members 


Select* 
Panel 
Members 


Intersections 

Actual travel speeds 

Traffic density (ADT) 

Business along roadway 

Topography (grades, 
curves) 

Structures (bridges, 
ramps) 

Absence of shoulders 

Absence of median 

Number of lanes 

Pavement surface 


1 
2 
3 
4 

5 

6 
7 
8 
9 
10 


1 
5 
2 
3 

4 

8 
7 
6 
9 
10 



NOTE: The factors were ranked according to the likelihood of their contributing to a hazardous 
materials motor carrier accident; the number 1 rank Is for the most important factor. (The factors 
apply to non-interstate highways only.) 

• Subset within the panel of traffic engineers and persons knowledgable about truck operations. 



-32- 



When the rankings of a subset of traffic engineers and persons knowledge- 
able about truck operations were computed, some substantial differences be- 
came apparent. For example, the subset ranked topography (curves and 
grades) as a much greater threat (ranked second) than travel speeds (ranked 
fifth). These rankings reflect the belief that a truck changing course is more 
likely to have an accident than one increasing its speed but proceeding straight. 
The "business along roadway" factor was also ranked higher by the select 
group than by the entire panel, presumably because the uncontrolled access 
and egress would create more need for maneuvering and stopping. Both 
groups put shoulders, medians, number of lanes, and pavement surface in 
the bottom half of the rankings. 



ACCIDENT RATE MODELS 

The study research and recommendations of the panel led to the conclusion 
that the relative safety of alternative routes could be determined by using 
multi-variate models which predict accident rates as a function of roadway 
features. (This assumes that historical accident rates are not available.) 
The variables cited consistently in the model literature as the most important 
factors in accident analysis were related to traffic conflicts and situations 
that demanded driver interactions, i.e., intersections and traffic volumes. 
The following discussion traces the review of possible models and the ration- 
ale for final model selection. 

Model Selection and Evaluation 

Because of the highly unpredictable nature of accidents, attempts to model 
their underlying causative relationships are constrained by the erratic and 
subtle influences which may cause accidents in some situations and not others. 
The same combination of physical factors may be present when an accident 
does or does not occur. It is thus not a simple matter to fit accident behavior 
to mathematical models. Taking into account these limitations, the study en- 
deavored to find models that produce consistent and intuitively correct pre- 
dictions. Another criterion in model selection was ease of application and use 
of readily available data. Table 6 is a summary of some of the models re- 
jected because of their complexity, poor predictive powers, unusual data 
requirements, etc. 

In the final analysis, three different models were chosen to predict acci- 
dent rates on the following three roadway types: 

. interstates; 

. urban arterials; and 

. rural highways. 



-33- 



TABLE 6 
MODELS REJECTED FOR PROBABILITY CALCULATIONS 





DEPENDENT 


INDEPENDENT 








MODEL 


VARIABLES 


VARIABLES 


N 


R' 


COMMENTS 


Interstate Accident 


• Total Accident 


•ADT 


• 1955-1967 


9 models: 


• Poor predictive 


Research Study- 1 


Rate 


• unit length 


• 39 states 


.237/.117/.149 


ability 


(1970) 




• years since l-S 


• 7,000 miles each 


.221 M 51 /.1 81 








• opening 


In l-S, rural ft 


.053/.024/.145 




SOURCE: (25) 




• # businesses/mile 

• # Intersections/mile 

• Interaction terms 


urban 
• 90 billion vehicle- 

miles 






Accident Rates/ 


• Total accident 


• ADT 


.03 mile segments 


All modele end 


• Rural only 


Design Elements ol 


rate 


• Grade (<4%<) 


Ohio - 46,591 


coefficient reported 




Rural Highways 


• One-vehicle 


• Intersections (one 


Fla. ■ 25,800 


are significantly 




(1968) 


accident rate 


or more) 


Conn. - 6,572 


different from 






• Multi-vehicle 


• Structure (one or 




O at P - .05 




SOURCE: (29) 


accident rate 

• Injury-producing 
accident rate 
(Includes total) 

• Curve (4%) 


• more) 

• Medlen 
•# lanes 

• Access control 








Cost ft Safety 


• Total accidents 


• Shoulder width 


Complete data 


Low . . . usually 


• Statistical 


Effectiveness of 


• PDO 


• Shoulder surface 


bases for Maryland, 


less than .08 


validity suspect 


Highway Design 


• Injury ft Fatal 


• Pavement width 


New York, and 






Elements 




• Terrain 


Washington 






(1978) 




• Number of lanee 

• Urban/rural 








SOURCE: (32) 




• ADT 

• Horizontal curve 








Environmental 


• Number of 


• Traffic volume 


• 13,498 accidents 


.89/.S9 


• Data requirements 


Determinants of 


accidents 


• Percent of 


• 135 two-mile 


.S9/.88 


too complex 


Traffic Accidents: 


• Accident rates 


developed frontage 


long segments 


.69 




An Alternate Model 




• Percent of 








(1974) 




commercial 
frontage 








SOURCE: (33) 




• Percent of 
population be- 
tween 16 end 24 

• Population density 

• Road type 








Effects of Roadwey 


• Injury accident 


• ADT 


• 92 sections from 


.69 


• Requires "access 


ft Operational Char- 


rate 


• Intersections/mile 


1 to 32 miles long 


AH variables In 


point Index" 


acterlstlcs on 


• Fatal accident rata 


• Signalized Inter- 


• 6,417 accidents 


final model 


calculation 


Accidents on Multi- 


• Total accident rate 


section s/mlls 




significant 




Lane Highways 




• Openings (excl. In- 








(1967) 




tersectlons/mlle) 
• Medlen width 








SOURCE: (34) 




• Speed limit 

• "Access point 
Index" 









-34- 



These three models are intended for use if the analyst lacks superior local 
knowledge. Models which have been developed locally or calibrated to local 
conditions will probably produce more accurate results. The three models 
were chosen for the study to provide the reader with a readily available 
reference for estimating accident rates. Similarly, the models which were 
rejected for universal application may prove better suited to a particular 
community's needs. 

Interstate Model 



This model predicts accident rates on the basis of average daily traf- 
fic (ADT) volumes (27). ADT has proved a reasonably good predictor of 
accidents on interstates, probably because of the high design standards on 
interstates and the general lack of variation in geometries. Thus, most acci- 
dents on interstates appear to be related to traffic conditions rather than to 
roadway characteristics (28). 

Urban Arterial Model 

A multi-variate linear regression model was chosen from the literature 
to predict accident rates on urban arterials (30). Urban arterials are major 
streets within urbanized areas that typically experience high traffic volumes 
and generally lack access controls . The urban arterial model predicts the 
annual number of accidents per mile on a segment based upon the ADT, 
number of heavy volume intersections per mile, and number of signalized 
intersections per mile. A conversion factor is used to change annual accidents 
per mile to accidents per million vehicle-miles . 

Rural Highway Model 

The rural highway model is specified to account for three variables: ADT, 
average highway speed (AHS), and terrain (27). AHS is defined as the highest 
average overall safe and comfortable speed attainable under light traffic con- 
ditions without exceeding the posted speed limits. In general, AHS equals 
the posted speed limit. The model uses three categories of terrain, as de- 
fined by the Highway Capacity Manual: level, rolling, and mountainous (31). 
(See Reference (31) for terrain definitions). 

All three models are discussed in greater detail below. 



DETERMINING THE PROBABILITY OF 
A HAZARDOUS MATERIALS ACCIDENT 

The technique developed from the above analysis to determine the proba- 
bility of a hazardous materials accident uses the accident rate for all vehicles 

-35- 



and subsequently factors that rate to reflect the much smaller share of haz- 
ardous materials vehicles in the traffic stream. The factor used to adjust 
total accident probabilities to hazardous materials accident probabilities was 
derived by dividing the number of hazardous materials accidents reported to 
the MTB during a 4 1/2 year period by the total number of vehicles accidents 
during the same period. Accident rates in themselves are not probabilities 
until they are adjusted to reflect the amount of exposure a vehicle experiences. 
Not all motorists face the same likelihood of being involved in an accident 
because the number of miles they drive varies. The sequence of steps to 
determine the probability of a hazardous materials accident is as follows: 

. Determine the accident rate for all vehicles on a particular 
roadway type. 

. Calculate the probability of an accident for any vehicle based 
on vehicle exposure (same as roadway length). 

. Factor the probability statement for any vehicle to reflect the 
incidence of hazardous materials vehicles in the traffic stream. 

The general form of the probability equation is: 

P (H.M. Accident) = (All Vehicle Accidents/ Vehicle-Mile)x(Segment 
Vehicle-Miles/Vehicle)x(H.M. Accidents/All Vehicle Accidents) 

The basic component of the probability calculation is the accident rate for a 
given segment or the number of accidents per million vehicle-miles (acc/mvm) 
Accident rates are often available from State or local highway departments. 
Alternatively, accident rates may be predicted using the models presented 
below if the rates are not available from historical data. The study recom- 
mends that historical data on accident rates be used whenever possible 
to preserve the greatest amount of accuracy in the risk analysis. However,, 
if observed accident rates are used on one route and compared to the predicted 
rates on an alternative route, the analyst should be aware of possible biases 
and try to compensate for potential over- or under-predictions by the models 
when applied in a particular community. This limitation is due to the level 
of precision of the predictive models and the underlying nature of the risk 
analysis technique. The risk values ultimately calculated for each route have 
limited meaning as absolute numbers; rather, it is the relative values that 
are important. If the calculated probability of a hazardous materials accident 
on one route is higher than on another route, the question of which route is 
more dangerous can only be answered if the analyst is confident that the pre- 
dicted values are truly representative of actual conditions. 

The probability component of the risk equation is based on the total acci- 
dent rate for all vehicles. The ideal measure would be the accident rate for 

-36- 



hazardous materials carriers or trucks in general. Unfortunately, this in- 
formation was not available, and total accident rates for all vehicles was 
chosen as the best alternative. Efforts to use only injury producing accident 
rates or fatal accident rates were unsuccessful because of an inability to 
relate hazardous materials releases to injury or fatal accidents versus total 
accidents. Because even under basically similar conditions, widely varying 
circumstances can result in serious damage in one accident and relatively 
minor damage in another, the study chose to use total accident rates and not 
attempt to hypothesize relationships for which no data could be developed to 
substantiate or refute them. 

The following sections present a methodology to calculate hazardous 
materials accident probabilities and identify the data required for these calcu- 
lations. The methodology is presented step by step; it begins by identifying 
the potential alternatives and segmenting the routes into components which 
can be conveniently analyzed. 

(1) Identify Alternatives and Segment Routes 

Identify Alternative Routes 

With the aid of regional road maps, a first-cut should be made at identify- 
ing those routes which: appear to satisfy community objectives; are reasonably 
compatible with existing hazardous materials trucking practices; and are void 
of physical mandatory factors which preclude their use. Limitations on staff 
time will preclude analyses of all potential alternatives, and this subjective 
selection of routes to be analyzed relies on a knowledge of local demography, 
roadways, and traffic conditions. The general rule-of-thumb to be followed 
at this stage in the analysis for the through transport of hazardous materials 
is to route them as much as possible on interstates because of their better 
safety records and away from populated areas. The analyst shoud be wary 
of excluding potential alternatives arbitrarily but must make some subjective 
judgements at this point to reduce the number of options to a manageable 
list. 

Segment Routes 

The purpose of segmentation is to divide the routes into discrete segments 
which can be analyzed more easily. The first criterion for segmentation is 
roadway functional type. The three categories to be used are: 

. interstate; 

. urban arterials; and 

. rural highways. 



-37- 



Within the interstate category, segments should be divided into two groups; 
urban areas, and suburban/rural areas. 

The second criterion for segmentation is census tract boundaries. These 
boundaries should be considered concurrently with traffic volume data (and 
the way the data are recorded along the route) or accident rates (and the seg- 
ments for which accident rate data have been collected) . Segment boundaries 
should be coordinated for the roadway probability data and census population 
data to facilitate the risk calculations which follow. Because risk is calculated 
by multiplying the accident probability times the number of people exposed, it 
is important to calculate the values for each component of the risk equation 
based on the same segment boundaries. 

After the accident rate methodology has been selected, routes are seg- 
mented within each roadway functional type whenever large changes in ADT 
or accident rates are observed. Thus, if the accident rate changes by + 25 
percent or more between segments designated by the recording agency, these 
segments will be logical breakpoints for the risk analysis. Likewise, if 
ADT changes of similar magnitude are observed, the analyst should segment 
the route to represent these varying traffic conditions without creating ex- 
cessive detail. Although the risk calculations are relatively straightforward, 
it is recommended that route segments range from 2 to 10 miles in length 
and that no more segments be designated than necessary, in order to minimize 
the number of subsequent calculations. 

(2) Calculate Accident Rates 

Secondary Data Sources 

If accident rates are available from direct observations on all route seg- 
ments, the analyst should use these values rather than the predicted values 
which can be determined using the models presented below. Accident rates 
on major roadways are typically available from State, regional, or local 
transportation agencies. 



♦Whether the analyst uses accident rates directly or predicts them on the 
basis of ADT and other variables depends on data availability. This is dis- 
cussed below under "Calculate Accident Rates," which should be read carefully 
before the routes are segmented to prevent unnecessary duplication of effort 
(e.g. , segmenting the routes on the basis of ADT data and subsequently 
discovering that accident rates are available but for different segment boun- 
daries.) 



-38- 



Predictive Models 

Accident rates may be calculated using one of the following three linear 
regression models: interstate, urban arterial, or rural highway. These 
models were chosen after a thorough literature review on the basis of statis- 
tical reliability and ease of application. Data requirements for the models 
are not thought to be excessive but may require some fieldwork, depending 
on the availability and quality of local traffic data and maps . 

Interstate Model (27) 

This model predicts accident rates on the basis of ADT volumes. ADT 
counts are normally available from either State or local traffic engineers. 
Traffic volumes may also be gathered through field observation although this 
process is time-consuming and expensive. The general form of the interstate 
accident rate equation is: 

y = a + bx 

where 

y = accidents per million vehicle-miles (accidents/mvm) 

a = a constant 

b = regression coefficient 

x = average annual daily traffic (in thousands) 

Table 7 presents the model constants and coefficients for interstates of 
varying widths and in different areas . Urban areas are defined as having 
a population of 5,000 or more. Suburban is defined as in urban area but 
not within a city's limits. All other areas are considered rural. For exam- 
ple, to calculate the accident rate on a 6-lane, urban interstate with average 
ADT of 80,000 vehicles, the equation would be: 

y = .80 + .011(80) 

or 
y = 1.68 accidents/mvm 



*See Appendix H for additional description of predictive equations 



-39- 



TABLE 7 
PREDICTIVE PARAMETERS FOR INTERSTATE EQUATIONS 



CATEGORY 


CONSTANT (a) 


COEFFICIENT (b) 


Rural / Suburban 






4-lane (ADT>15,000) 


0.83 


0.007 


6 -lane 


0.45 


0.012 


8 -lane 


0.42 


0.007 


Urban 






4-lane 


0.80 


0.020 


6 -lane 


0.80 


0.011 


8 -lane 


0.73 


0.007 


10 -lane 


0.16 


0.010 



SOURCE: (27) 

Urban Arterial Model (30) 

A multi-variate linear regression model is used to predict accident rates 
on urban arterials (30). Urban arterials are defined as major streets within 
urbanized areas that typically experience high traffic volumes and generally 
lack access controls. The general form of the equation is:* 

y = -0.261 + 1.256 Xj + 3.909 x 2 + 6.086 x 3 

where 

y = number of accidents per mile annually 
x^ = volume (ADT) in thousands of vehicles 
x 2 = number of heavy volume intersections per mile (inter- 
sections with arterial streets) 
X3 = number of signalized intersections per mile 

The model predicts annual accidents per mile rather than accidents per mil- 
lion vehicle-miles. To convert to an accident rate, the predicted y value 
is divided by ADT times 365 days /year: 

y(acc/mi/yr) 6 

ADT(veh/day) x 365 (days/yr) x 10 = * (acc/mvm) 



-40- 



Rural Highway Model (27) 

The rural highway model is specified with three independent variables: 
ADT, AHS, and terrain. AHS is defined as the highest average overall safe 
and comfortable speed attainable under light traffic conditions without exceed- 
ing the posted speed limits. In general, AHS equals the posted speed limit. 
Three categories of terrain are also used in the model: level, rolling, and 
mountainous (31). 

The rural highway model was calibrated on accident rates and travel con- 
ditions for a conventional two-lane uncontrolled access highway with rolling 
terrain and AHS greater than 55 mph. The general form of the equation for 
the base case is:* 

y = 1.87 + 0.65/x 

where 

y = number of accidents per million vehicle-miles 
x = average annual daily traffic (in thousands) 

The variables terrain and AHS are used as factors to reflect the influence of 
variations in these characteristics on the base case. Thus, when the terrain 
is level the total accident rate should be decreased by 20 percent; in moun- 
tainous terrain it should be increased by 40 percent. When average highway 
speeds are equal to or less than 55, the predicted accident rate should be 
increased by 80 percent (reflecting the fact that more dangerous roads will 
have lower AHS). Table 8 summarizes the rural highway prediction equation 
and adjustment factors . 

TABLE 8 
RURAL HIGHWAY PREDICTIVE 
PARAMETERS AND ADJUSTMENT FACTORS 



CATEGORY 

Rural 2-lane 
Conventional 


BASE CASE 


TERRAIN FACTORS 


AHS FACTORS 


EQUATION 
y = 1.87 + 0.65 

X 


FLAT ROLL MOUNT. 
-0.20 0.0 +0.40 


^55 ;» 55 
+0.80 0.0 


SOURCE: (27) 









*See Appendix H for additional description of predictive equations , 



-41- 



Roadway Inventory Worksheet 

Worksheet 1 (Table 9) is structured to record the necessary roadway data 
for the segments comprising each alternative route . Some of the columns are 
only relevant for particular roadway types, and the data required for each 
segment are a function of the predictive model to be used. The segments are 
numbered to assist in keeping track of them during the calculations. One 
technique is to assign each alternative route a number and each segment within 
the route a letter (e.g. , 1-A, 1-B, 1-C; 2-A, 2-B, 2-C, etc.). A large part 
of the data can be gathered from secondary sources such as city or State traf- 
fic counts, roadway classification maps, USGS topographic maps, etc. Other 
variables, such as the number of signalized intersections per mile, may be 
more easily collected through observation. None of the data requirements for 
the predictive models are exotic , and the analyst should have little trouble 
assembling this information. Obviously, if the accident rates are available 
from a transportation agency, it is only necessary to fill in columns 1,2, 
5, and 11 (12 is optional), as the information requested in the other columns 
is for estimating accident rates. 

(3) Convert Accident Rates to Probability Statements 

The probability of any vehicle being involved in an accident on a specified 
segment is calculated by multiplying the segment accident rate times its length 
(or amount of exposure). On Worksheet 1, this is the product of column 5 
times column 11. The general form of the equation is: 

P (Accident on Segment i) = x^ accidents/vehicle-mile x 1^ mile 

where 

Xj is the segment accident rate*; and 
L is the segment length in miles. 

For example, the probability of any vehicle being involved in an accident on a 
roadway segment which is 3 miles (4.8 km) long and has an accident rate of 
2.0 accidents/mvm is: 

P(accident segment i) = 2.0 accidents/mvm x 3.0 v-m/v 

or 

P(accident segment i) = 6.0 x 10~ b accidents/vehicle. 



*Note: The accident rate is expressed in accidents per vehicle-mile rather 
than accidents per million vehicle-miles. 



-42- 



> 

at 

z 
u 

> 
z 

> 

a I 

2 o 



5 

w 

S 

at 

t 



5 -S a 



5 

X - 




• 










e 

eg 
SSf 

3 a 3 
||I 














■K 
QC 


a 














- 














- 














II 

li 


1*1 

5 

UJ 














* 














m 

M 

i 
















^ 














§i 




























5 

CO 

5 














ii> 














M 














is 














Mi 
X 

3 

St 


Q 
O 














4p 















-43- 



APPLICATION OF PROBABILITY METHODOLOGY 
TO WASHINGTON, D.C. CASE STUDY 

Introduction 

The Washington Metropolitan area is served by several interstates, 
including a circumferential beltway. The SMSA population in 1970 was 2.9 
million, and dense residential development has occurred along many parts of 
the interstates serving the downtown area (particularly 1-395). Residential 
development has also occurred along the Beltway, with heavy concentrations 
in Northern Virginia and less activity to the east in Prince George's County. 

For purposes of the case study, truck traffic was analyzed for vehicles 
starting from points south of Washington and bound for Route 50 in Maryland. 

Each of the analytic tasks presented earlier is applied to the Washington, 
D.C, case study, as described below. 

(1) Identify Alternatives and Segment Routes 

Establish Routing Objectives 

The purpose of this exercise is to select a through route for hazardous 
materials carriers bound for Route 50 from points south. The route selected 
will be the one presenting the smallest hazardous materials safety risk to 
area residents. 

The regional highway system offers several opportunities to bypass popu- 
lation centers. In many instances, current trucking practices are already 
avoiding densely populated areas. However, food and lodging available within 
Washington, D.C. , may be the cause of some of the hazardous materials 
trucks that have been observed passing through populated areas; other drivers 
may believe the more circuitous highway routes have higher time costs. 

Identify Alternative Routes 

Discussions with the District Department of Transportation and inspection 
of regional road maps led to the selection of the four alternative routes identi- 
fied in Figure 4. Route 50 may be reached from the south via four major 
highway routes: 

. 1-495 (Beltway) to Route 50 (Alternative 1); 

. 1-495 to 1-295 to Route 50 (Alternative 2); 



-44- 







"■Mil Ml. 



^ 



o 

H 

o 
z 

I— I 

s 

en 
Eh 

o 

s 

H 

O 
c« 

2 

o 

OS 
Eh 

c/3 

Ed 

o 

ca* 

>* 

< 



o 

X 

o 



Eh 



-45- 



. 1-395 (Shirley Highway) to 1-295 to Route 50 (Alternative 3); and 

. 1-395 to Route 50 (Alternative 4). 

The last routing alternative takes trucks through downtown Washington past 
the Capitol Hill area. The other three alternatives are primarily interstate 
routes until they meet Route 50 (well outside downtown). The total travel 
distances of the alternatives are relatively similar, and the routes were judged 
to be reasonable substitutes for one another. 

Identify Mandatory Routing Variables 

There are no physical restrictions on hazardous materials movements on 
the interstates or Route 50. The District recently enacted an ordinance which 
prohibits hazardous cargoes from entering the highway tunnel under the Mall 
near the U.S. Capitol. However, this fact does not preclude evaluation of 
Alternative 4, as the analysis will determine which of these routes poses the 
smallest overall risk. Although the District has chosen to apply one criterion 
in designating its hazardous cargo route, the case study aims to evaluate the 
alternatives without precluding any options on the basis of an existing routing 
ordinance. 

Segment Routes 

The alternative routes were segmented on the basis of ADT and census 
tract boundaries as illustrated in Figure 5. This decision was made after 
contacts with State and local transportation agencies revealed that it would 
not be possible to obtain historical accident rate data for all roadway seg- 
ments . 

The routes were segmented on the basis of classification schemes used by 
the DOTs of Virginia, Maryland, and the District to measure traffic volumes. 
Simultaneously, census tract maps were consulted in order to choose segment 
breakpoints which would allow uniform calculations of the accident probabili- 
ties and consequence values for the same stretch of roadway. The other seg- 
menting criteria was roadway type. A route was segmented at the point where 
the roadway type changed from interstate to urban arterial. 



Accident rate data were available on most segments of the interstates. How- 
ever, the predictive models were used for the case study in order to assess 
their usefulness. In general, the predicted values corresponded well to the 
actual values. 



-46- 




-47- 



(2) Calculate Accident Rates 

Calculations for both interstate and urban arterial segments were made 
using the default models described earlier. Data for the models were com- 
piled by contacting State and city agencies as well as by on-site inspections 
of the alternatives. Tables 10 and 11 present the roadway inventory work- 
sheet and accident rate calculations, respectively, for Alternative 1. The 
calculations which convert accident rates to probability statements are also 
presented in Table 11. The accident rates for all segments of Alternative 1 
are quite similar, as the whole potential hazardous materials route is an 
interstate highway. 

Calculations for all four alternatives and their corresponding segments 
are presented in Appendix D, along with the roadway inventory sheets. The 
models 1 predictions were reasonable when applied to the other alternatives, 
and the predicted urban arterial accident rates were about twice as great as 
the predicted six -lane interstate rates. (The urban arterial in Washington 
has limited access from South Dakota to the Beltway and, consequently, its 
rates on these segments are lower than might be expected on urban arterials 
with uncontrolled access.) 

(3) Convert Accident Rates to Probability Statements 

The right-hand column in Table 11 contains the probability calculations 
for each of the segments in Alternative 1 . Probabilities are calculated by 
multiplying the accident rate times the amount of exposure (or segment length) 
to determine the likelihood of any vehicle being involved in an accident on 
that segment at any point in time. The probability calculations for the four 
alternatives are presented in Appendix D and summarized in Figure 6. 



SUMMARY 

This section documented the study's investigations in the field of accident 
causation, and the development of a methodology to calculate accident prob- 
abilities given certain roadway and traffic information. The methodology is 
structured to allow planners to use their own local information or, if desired, 
to use the default parameters and models recommended in the text. The 
heart of the probability calculation is the accident rate , and it is recommended 
that observed rates rather than predicted values be used whenever possible. 
However, if the observed values are unavailable, the recommended predictive 
models will produce results that are intuitively correct and preserve the three 
roadway types' relative differences in safety. 

The probability values calculated for the interstate segments in the Wash- 
ington, D.C. , case study are quite small and reflect the overall safety of 
interstate highways. Large differences between most of the segments of 

-48- 

















M 














e* 














K 














„ 














s & 














b * 














£ 














el 














si? 














8s 


; E 

i s. 


U9 


I 

^ 


9- 




Hi 






\ 






























15 


i 














K 


a 


1 


i 


1 


I 


i 




3 
















■E 


■c 




i 


1 


l 


i 




3 


















md 


1 


i 


1 


I 


i 






Mi 
















-^ 














ii 


a 


1 


i 


1 


I 


i 




is 


o- 




























SS 


IN 


1 


i 


1 


I 


i 




































* 


s 


| 












K 










l 


i 




(S 
















to 


^ 






























































* 


1 


i 


1 


l 


i 




1 1 


s 


s 


e 


8 


e 
a 




a _ 
3a 














fe = 


8 






! 


8 






IO 


n 


e 


» 


a 




HI 

5 






n 


a 


r* 




m 


g 












" s S 

m 3 2 


3 


: 


- 


: 


e 
■ 

•fi 




= 3" 










3 


















i°5 


a 


CD 


IB 


a 


a 




IE 














I 2 


2 


2 


2 


w 


2 




s 
u 


o 
5 




i. . 


ill 


K C. < 


88 






4N 


< 


2 


9 


2 


2 





-49- 



z 
© 

3 
3 



z 
< 
w 

H 



H 
Z 
U 

a 

D 

u 



D £ 



£ CB CO 
<OCL 





E 


E 


E 


E 


E 




> -c 


> 'ff* 


> 'ff- 


> "C* 


> -c- 


>■ 


e-i* 


E-l® 


E^» 


Ef ® 


E-|«p 
"5=2 


o ? ° 


o ? ° 


■5 E o 


o I ° 


J 


8 >*- 


o >^ 


o i 1 " 


o >,*" 


° «£. 


2 


3 <5 


05 "^ X 
vO CO H 


" s 


# >cr $ 


c5 vO ^ 


< 
m 
O 


co 10 00 


rH • r». 


^> rv-> 2° 


CO • 00 


CT\ • 00 


to ^ ^o 


in ho\ 


VO ^ 0\ 


<T v£> rH 


m r^ o 


II II 


II II 


ir ii 


Tf x ff 


if X ^ 

II rH 


a. 


5" 

u 
o 


5" 
o 


o 


5" 
o 


u 




o 


a 


u 


o 




El 


CB 

ST 


CO 
CL 


•5> 

CL 


CO 
CL 














? 












> 












E 


















/—^ 






o 


/""N 


/—s 


o 


•~\ 


^~\ 


Si 


m 
d 


00 

00 


rH 
O 


rH 


o 
m 


< ^ 


o> 


00 


H 


00 


CT\ 


ITR 
erve 


v — > E 


^^ s 


^-^ S 


N— ' E 


s -" / E 


CM g 


CM B 


CM g 


CM S 


CM S 


Z CO 


rH -«>. 


H \ 


rH \ 


rH --». 


rH \ 


in ^ 


O O 


o 


a 


O O 


o 


QO 


O 
CO 


o a 
co 


o o 
co 


O 
CO 


o a 
co 


s 


+ 


+ 


+ 


+ 


+ 


vO 


\£) 


CM 


m 


o 


<! 


m co 


IT) rH 


u~> vO 


m co 


m cxi 


-<r m 


o- m 


•<r vo 


<* <r 


<j- m 














CO 

E 


H 


rH 


rH 


rH 


rH 


II ll 


II ll 


II II 


II II 


II II 


CO 












tu 


>■ 


>- 


>- 


>" 


>" 


H 












Z 
UJ 

s 












< 

1 


■ 


1 


1 


w 


a 


1 

H 


i 

rH 


1 

rH 


1 


rH 


UJ 












(0 








1 


1 

1 




r4 


M 


M 


u 


u 




a) i 


CU 1 


a) i 


CU 1 


CU I 


— 1 


+J rO 


■U ,r> 


•U rQ 


4J rQ 


+J ^1 


UJ 


a 3 


a 3 


3 3 


a 3 


3 3 


a 


H tO 


M CO 


M CO 


H C>2 


H C/l 


O 


CU ^. /-s 


CU ^~. /-N 


<U \ ^-v 


CU ~- /-N 


CU "^ /-N 


<U 4-> rH 3 


CU -U» rH 3 


CU -U rH 3 


CU 4J H 3 


CU 4J rH fi 


S 


3 cO cO co 


fi cO cO cO 


3 cO cO cO 


3 CO cO cO 


3 cO cO cO 




oj +J >-i ^Q 


CO 4J U X> 


cO -U >-l rQ 


H) *J M J3 


CO -U )-l rQ 




hJ co 3 U 


hJ CO 3 U 


hJ CO 3 U 


rJ CO 3 H 


hi M 3 H 




Pi 3 


Pi 3 


Pi, 3 


P4 3 


P4 3 




V© v— ' 


v© ^ 


v£> N^ 


vo v — ' 


vo — 



• 




































E 












• 












o 










^ 


• 
> 




m 

9 






C 


C 
O 




E 

• 






8 














E 




o 


•> 




e 






£ 






>« 


m 


^ 


9 
> 


E 




s 


c 



c 
* 


e 
o 


• 


• 


£ 
m 














u 


o 


M 


£ 


£ 


o 


u 


o 


E 


• 


• 


Sf 


m 


« 


> 


> 


a 


II 


II 


n 


II 


II 


ll 


> 


u 
o 


E 

> 


E 


> 


o 

o 


•o 
c 


a 


E 


> 




ct 






-50- 




-51- 



the four alternatives were not observed because of the general similarity of 
the roadways and traffic conditions. High accident probability values in the 
case study generally reflect greater segment length (or exposure) rather than 
higher accident frequencies. On the basis of the probability values alone, it 
is impossible to make any judgements about which route is safer for hazardous 
materials shipments. A comprehensive analysis of the routing alternatives 
must include the potential consequences. The following section describes a 
technique for estimating the potential impacts of a hazardous materials re- 
lease and applies this methodology to the four routes in the case study. 



-52- 



REFERENCES 



1. Jennings, W. C. and Rothberg, P. F. , Hazardous Materials Transpor - 
tation: A Review and Analysis of DOT'S Regulatory Program , Congres- 
sional Research Service, the Library of Congress, prepared for the 
Senate Committee on Commerce, Science and Transportation, Washing- 
ton, D.C., March 8, 1979. 

2. Announcement of Proposed Rulemaking Highway Routing of Radioactive 
Materials, Docket No. HM-164, Materials Transportation Bureau, 
Research and Special Programs Administration, U.S. Department of 
Transportation, 43 FR 36492, August 17, 1978. 

3. Notice of Proposed Rulemaking, Highway Routing of Radioactive 
Materials, Docket No. HM-164, Notice No. 80-1, Materials Transpor- 
tation Bureau, Research and Special Programs Administration, U.S. 
Department of Transportation, 49 CFR Parts 173 and 1977, January 
31, 1980. 

4. Telephone Interview with Carl Sawyer, Senior Protection Analyst, 
Regulatory Improvements Branch, Nuclear Regulatory Commission, 
February 14, 1980, (202) 492-7000. 

5. U.S. Environmental Protection Agency, Development of an Emergency 
Response Program for Transportation of Hazardous Waste , Contract 
No. 68-01-3973, Envirex, Inc., Milwaukee, Wisconsin, 1979. 

6. Graham, M. D. , etal., Final Report AASHTQ Task Force on the 
Movement of Hazardous Materials , AASHTO Highway Subcommittee on 
Highway Transport, Albany, New York, December 1978, unpublished. 

7. California Highway Patrol, Explosives Routes and Stopping Places , 
HPH 84.3, Sacramento, California, August 1973. 

8. National Tank Truck Carriers, Inc. V. Edmund Burk, et al., op. al. , 
U.S. District Court for Rhode Island, Civil Action No. 78-0621. 

9. Telephone Interview with Deborah Farmer, Research Assistant, Inter- 
national Bridge, Tunnel and Turnpike Association, June 12, 1979, 
(202) 659-4620. 

10. International Bridge, Tunnel and Turnpike Association, Compendium 
of Regulations, Shipments of Radioactive Materials , Washington, 
D.C. , February 1974. 



-53- 



11. Besselievre, W. C, Editor, A Summary of Highway Facilities Where 
Hazardous Materials Are Restricted , FHWA, Washington, D.C., 
January 1977. 

12. Telephone Interview with Official of the Baltimore Department of Transit 
and Traffic, June 11, 1979, (301) 396-3033. 

13. Telephone Interview with Deputy Commissioner, Chicago Bureau of 
Street Traffic, June 11, 1979, (312) 744-4684. 

14. Telephone Interview with the Inspector of the Dallas Fire Department, 
June 8, 1979, (214) 670-4308. 

15. Telephone Interview with the Los Angeles Division Engineer, Depart- 
ment of Transportation, June 8, 1979, (213) 485-2755. 

16. Telephone Interview with the New York City Highway Department Attor- 
ney, June 8. 1979, (212) 566-5448. 

17. U.S. Department of Transportation, Inconsistency Ruling (IR-1) , Mater- 
ials Transportation Bureau, Washington, D.C., April 4, 1978. 

18. Telephone Interview with the Portland, Oregon Director of the Bureau 
of Emergency Services, June 8, 1979, (503) 748-4580. 

19. Telephone Interview with Providence City Solicitor, June 8, 1979, 
(401) 421-7740. 

20. Telephone Interview with the Salt Lake City Traffic Engineer, June 12, 
1979, (801) 535-7811. 

21. Telephone Interview with the Savannah City Manager, June 8, 1979, 
(912) 233-9321. 

22. Philipson, L. L.; Rashti, P. J.; and Fleisher, G. A.; Statistical Anal- 
ysis of Commercial Vehicles Accident Factors , USDOT FHWA, 1978. 

23. Vallette, G. R.; McGee, H.; Sanders, J. H.; and Enger, D. J.; The 
Effect of Travel Size and Weight on Accident Experience and Traffic 
Operations, DRAFT , USDOT FHWA, 1979. 



-54- 



24. Roff, M. S.; "Interstate Highway Accident Study, " Highway Research 
Board Bulletin 74 , 1953. 

25. Fee, J. A., Beatty, R. L., et al.; "Interstate System Accident Re- 
search Study - 1," USDOT FHWA, 1970. 

26. Vostrey, J. and Lundy, R.; "Comparative Freeway Study," Highway 
Research Record 99 , 1965. 

27. Smith, R. N.; "Predictive Parameters for Accident Rates," State of 
California Division of Highways, 1973. 

28. Fee, J. A.; Dietz, S. K.; and Beatty, R. L.; Analysis and Modeling of 
Relationships Between Accidents and the Geometric and Traffic Char- 
acteristics of the Interstate System , USDOT FHWA, 1969. 

29. Kihlberg, J. K. and Thorp, K. J., Accident Rates as Related to Design 
Elements of Rural Highways , National Cooperatives Highway Research 
Program Report No. 47, 1968. 

30. Mulinazzi, T. E. and Michael, Harold L.; "Correlation of Design Char- 
acteristics and Operational Controls with Accident Rates on Urban 
Arterials," Proceedings of the 53rd Annual Road School Engineering Bul- 
letin of Purdue University, Series No. 128, March 27-30, 1967. 

31. "Highway Capacity Manual 1965," Highway Research Board, Special Re- 
port 87, National Research Council, 1965. Definitions are as follows: 

Level terrain - any combination of gradients, length of grade, 
or horizontal or vertical alignment that permits trucks to main- 
tain speeds that equal or approach the speed of passenger cars. 

Rolling terrain - any combination of gradients, length of grade, 
or horizontal or vertical alignment that causes trucks to reduce 
their speeds substantially below that of passenger cars on some 
sections of the highway, but which does not involve sustained 
crawl speed by trucks for any substantial distance. 

Mountainous terrain - any combination of gradients, length of 
grade, or horizontal or vertical alignment that will cause trucks 
to operate at crawl speed for considerable distances or at fre- 
quent intervals. 



-55- 



32. Roy Jorgensen Associates, Inc.; "Cost and Safety Effectiveness of High- 
way Design Elements," National Cooperative Highway Research Program 
Report 197 , Transportation Research Board, Washington, D.C., 1978. 

33. Snyder, J. C, "Environmental Determinants of Traffic Accidents: An 
Alternate Model," Transportation Research Record No. 486 , 1974. 

34. Cribbins, P. D., Arey, J. M., and Donaldson, J. K.; "Effects of 
Selected Roadway and Operational Characteristics on Accidents on 
Multilane Highways," Highway Research Record No. 188 , 1967. 



-56- 



3. DEVELOPMENT OF A HAZARDOUS MATERIALS 
CONSEQUENCES ASSESSMENT METHODOLOGY 



CONCEPTUAL FRAMEWORK 

Developing a methodology to assess the consequences of potential hazar- 
dous materials accidents requires an understanding and knowledge of many 
factors. High on the list of factors would be the type and quantity of hazar- 
dous materials carried as well as the specific characteristics of each mate- 
rial. Equally important is a definition of what quantitative factors are to be 
used as consequence descriptors. Additionally, one would want to have an 
understanding of how the type and amount of hazardous materials interact 
with the consequence descriptors. All of these issues are discussed below 
as they relate to hazardous materials route designation. 

The Problem of Lack of Exposure Data 

One of the most important findings of this study is that there is no com- 
prehensive source of hazardous materials exposure data at the national level 
for motor carriers.* This fact was the overriding factor in the development 
of the consequences methodology. Without "hard" data to suggest what haz- 
ardous materials are carried what distances and in what parts of the country, 
it is difficult to focus on the most likely hazardous materials accident conse- 
quences for a particular route. 

Without exposure data, in terms of ton-miles per commodity, the study 
was left with several alternatives. The worst case commodity for all hazard- 
ous materials could be used in the analysis but, as this section will indicate, 
there is no assurance that the worst case commodity is carried uniformly 
over the entire country. In fact, just the opposite is more likely. Another 
alternative examined was to seek exposure data at the State level. This search 
found only one State with exposure data (1). 

The last reasonable alternative examined was to analyze the hazardous 
materials roadway accident data and postulate that accident experience is 
a surrogate for exposure. Other alternatives, such as conducting surveys 
and examining ICC data, were outside the scope of this study. 

In view of these alternative courses of action, the Materials Transpor- 
tation Bureau's (MTB's) hazardous materials incidents data base (2) was ex- 
amined along with selected accidents from the Bureau of Motor Carrier Safety 



*This conclusion has been documented by others (4) 



-57- 



(BMCS) data base. The MTB data base contains hazardous materials inci- 
dents and accidents that have been reported by the motor carriers on DOT 
Form F 5800.1 (10-70).* As required by the Code of Federal Regulations, 
carriers use this form to report incidents by commodity, location, and sev- 
eral other factors. The information is then coded by MTB and analyzed. 
The accident reports among the total incident reports are coded by MTB as 
the reports are received from the carriers. The accidents can then be col- 
lated by hazardous material class . (See Appendix A for the definition of 
the respective classes of hazardous materials.) Collation of the MTB rec- 
ords was done nationally for the period July 1973 to December 1978, as 
summarized in Table 12. 

Table 12 indicates that about 90 percent of the accidents involve com- 
bustible liquids, flammable liquids, and corrosives. Intuitively this seems 
correct because many of the materials in these classes are commonly used 
in industry and by consumers (see column 4 of Table 12). This relationship 
was also supported when the accident experience was compared with the pre- 
viously mentioned State survey data. 

Table 13 compares the MTB accident experience for the Commonwealth 
of Virginia to a survey of vehicles carrying hazardous materials on Vir- 
ginia highways (1). For the most frequently carried classes of hazardous 
materials--combustible liquids, flammable liquids and corrosives- -the 
accident experience and survey results are very similar. Without the bene- 
fit of other State surveys, it is difficult to give statistical validity to the 
hypothesis that the accident data are a valid surrogate for exposure. How- 
ever, at the same time, and without other means to identify the type, dis- 
tances, and location of the carriage of hazardous materials, the MTB data 
appear to be the best available default parameter for identifying what mate- 
rials are being carried in a particular area. 



The MTB requires that any interstate carrier (common, contract, or pri- 
vate) of hazardous materials in sufficient quantity to warrant placarding file 
DOT Form 5800.1 in the event of any incident or accident that results in the 
release of hazardous materials. The BMCS requires all interstate carriers 
(except private carriers of farm-to-market produce and postal carriers with 
vehicles having a gross vehicle weight rating of 10,000 pounds or less) to re- 
port accidents that result in death, injury, or $2,000 or more in damages (5). 
An incident is defined as any occurrence which results in the unintentional re- 
lease of hazardous material. An accident is an incident which occurs on a 
roadway and involves vehicular transport of the hazardous material. 



-58- 



O-JOin-^COCOO 



•O O^ O O f*^mOON'*'iO-.TrM 



^h H O O 

o d o o 



n n cn N Hin H^r 
dddddddd 



CO PJ H sj H M 

o o d o o d 



CM -a- >» 
o o PJ 



ooooc ooo 



IX i* 

o 



nifl H4NNHOOH 



O^HO»nr*-.<r>-i<TratHrno 



ON sO rt PH 



-JvO<CU*lf^00M 



io Oiod do 



<r ao •/■* <r 



oo <— i in m ^ o i— i r* 







01 






4-1 


h 




C 


01 




(11 


XI 


44- 


■o 


h 





•H 


3 




u 


z 




< 



Noovowmax'CMN 



csiOOtHfNOfMOaor^tNOO 

HHHNffunNHMNinm 



m fs| iH r- 1 



JOf^oo r-^-j-fOcyirsiiA i/i x O ia 



n^M(Nir--vTC 



Z x. 

22 

CQ 







m 




u 












CO ti. 




c 














-i o 


01 






4- 


X 












z 






to 




„ 




,_, 


►J 


J 








o oi 




XI 








i 




z 


3 O 
01 ^ 


4J 
•H 




fci 


oi 
tl- 






0) 


CO 




01 


^ 






O rH 




%T 




a 


u 


u 








• > 




• 3 




CO 




J 




01 


n 


ii- 


01 


U 








1) 


o 












.* • 








u 












2 1 





CO H 












-o 


u c 






01 


X 


01 




4- 






c 


CO 






U Z P 








4-1 












u 






d 








-rH 


c oi 


3 


a 


k. 


•H 


4J 




4-1 


z 













m 4_i 








qj 




to 






to 


■o oi 


4-1 


d C 












•~t 


01 S 


0) 


>u 




r 














^ O 






-Q • 01 








Ou 


•H 










•h a: 


01 


• o 




z 




1 







A. O 





4U 






u 


-o 


z 








0) • 






u cr pu 










4-1 


o 






d 


3 


Rh 


Z -H 










CO 


a. 


u 


tH 


4- 







<H 




ig 






•H Z 






3 -h 










n 










tr *-» 




4-1 








<D 






(0 


■0 


Z 


4-1 


M 




U 


XI 


■H 












UJrt 








CO 


■H 


z 






z 


■H C 




• n 




01 


CO 


C 




01 


3 01 


> 




■H 


4J 


X 


< 


4- 


iCt 




to 


-tH 01 






•H 


.-H 




01 




a 






01 




J -rt 


•H 


tT -H 


01 


3 




U) 




«H 


u 01 


X 


E 


z 




u 




<g 


01 




3 


3 TO 






4J U O 


•H 


Tt 


c 


c 








c 




TO 


o 


■H > 


c 


u. 


d 






Xi 


O 01 




3 




z 


o 


u 


CJ 






O 


<T O 






r-l 01 


o 


O 


Hi 




<— i 


c 










u 0. 




►J < 


T* 












x: -h 


E 


■H 






o. 






a 




t* 




E 


c 


TO 3 01 






(/> 


z 





01 


u 




X, 


c 


01 






1-1 


z 


4-1 


u 




a. oi 


3 


C 


E 




p>. 


E 





£ 


M 


■a 


-J U 


3 


01 4- 


X! XI 13 






o 




M 


> 


11 


01 


o 


01 CD 


E H 


o 







c 


01 




01 Ji 


•-H 







c 


I 


O 


4- 




01 


>< 


a 


•-H 


00 01 


a. E 3 


01 


01 


c. 


H 


*J 




x: 


4J 


o 


e e 


3 


it oi 


0) 


u 




"H 


£ 


a 


o o 


XI 






o 




4- 


Ul 


HX 


X 


rM E 




S?-S 


0) O 4-4 


3 


3 


01 




HI 





*j 


u 




01 o 


M 


iH 3 


a 


o 




TO 


4-1 




x: E 


o 






1 


ID 


5 


•H 


X 


u 


5 


o □ 


01 


< u u 


fit 


U. 


u 


o 


PL) 


CO 


o 


< 


< 


u o 


U 


u. u. 


o 


X 


o 


B. 


o 


u. 


0- CO 


CO 


< 


•2 


u 


Z 


O 


O 


<_> o 


X 


o o 



c 


^H 


3 




T) 




o 


z 











•H 


4* 








t/a 







3 




2 


■^ 






u 


>s 




■- 




T3 




0) 




L- 




£ 








•D 




Q 


-J 


D 


cr 






■H 









tf) 









c 


c 


01 


01 







to 




(Q 


0) 


■n 


T3 


.£ 








^ 


-C 






O. 


W) 


tn 




u 


u. 




CI 




3 


D 






n 











O 


H 


£ 


u 




u 




c 


c 




V 






U 


B 


o 


C I- 








Jj 


01 


T) 




cn c 


1 


•D 


C 


lt; 


to 


cy 










■H 


B 


c 


4- 


c 


c *-> 


vj 


to 


U 


M 


M 


o 


c- 


Pu c 



Xt 4m XI 

a u 

< 






-59- 



,—irH,— i h r- ii— ( eg •>• -h <•■"» 
OOOOOOOOOO 



MCOcco^iAinrisoco* 

OOOfH--IOT-lOO»H«N 



m m in in iri ia 



o> in i^* -j- d m O 



n cn n m <■ n rN 



E 


i- 






co 


in 


< 








3 


o 


OS 









~i 


■^ 


a> 












•H 


T 


r 


0) 






co 


< 


< 








u. 


OL 


oa 



o jo a -h 

-H g rH U 

a o cj u 



u 



CO 



J CJ 

> .H 

U -H U 
(LI CO 



<U CJ M C g 

at > > h at E 

CO 1J-H-HP. X^H< 

(J 41 CO 01 UH 

JJ O O O IH fc 

*-t CO rH »H rH J3 O. »H 01 

■ oaccauoai 

r-COXXX-HUB-U 

OBUUKIMDO 







O* -H 


^3 


■H 




CO 




d 




•H 


►J • 


— 1 


CJ 


•V 


•o 








►J 


CO 


3 


< 


■ri 


•H 




z 







oo . 






CJ 


X -a 




-a 


3 


CO 

-o 


c o 

1-1 • 


S, 


CJ 
•H 


■< 


O -H 

- u 




■H 


M 


o 


c z 


4J 


h 


CJ 


■a < 




3 





to 


CO 




O 




^ 




cr 


AJ 




<u a- 


CO 




U 


X o 




•H 


E0 


o 




CO 


J= 









■J 




•H 


u - 




CJ 


J= 


e u 






CO 


4J 









ft 


3 3 


h 


-a 


4J 


CO 


a M 


cj 


h 


CO 


•H W-t 


ai 


•H 


4-> 


3 


E l- 


0) 


13 





■O iH 


-E 


CJ 


CO 


CO 


o 




P*. X. 


O 3 


4J 


< 


CO 


u 


U O 


H 


X 


Oh 


CO 10 


o 



c . S V 
co -3 , - 



■H co -H 

u rH 3 



jo u-i -a 

5 °H 



T3 « 



O O fll <-h 



13 *J o 5 



c 


_ * 


ct-i 




0> 






cu 


-n 


B - 


iH 




•H 


CO 


f-t 


01 


CJ 


J3 p. 


< 


3 


CJ 


•J O 






CO 


JJ 








01 






01 


K 01 






c 


2 -c 









S u 







•H S W 

CO 

i, J3 CU 



-60- 



TABLE 13 
HAZARDOUS MATERIALS ACTIVITY IN VIRGINIA 



H.M. CLASS 


MTB ACCIDENT 

RECORDS* 
(7/73 - 12/78) 


VA DEPARTMENT OF 
TRANSPORTATION SAFETY 
"SURVEY" 
(8/77) 


Number of 
Accidents 


Percent of 
Total 


Number of 
Vehicles 


Percent of 
Total 


Combustible Liquid 

Flammable Liquid 

Flammable Solid 

Oxidizer 

Nonflammable Gas 

Flammable Gas 

Poison 

Radioactive Materials, 

Explosive 

Corrosive 


13 
31 



2 
1 

1 
5 


24. U 
57.4 
0.0 
0.0 
0.0 
3.7 
1.9 
0.0 
1.9 
9.3 


174 
303 
10 
12 
42 
52 
13 
1 
15 
79 


24.8% 

43.3 

1.4 

1.7 

6.0 

7.4 

1.9 

.1 

2.1 

11.3 


TOTAL 


54 


100Z 


701 


1002 



*Not updated by BMCS data. 



SOURCE: (1), (2) 



-61- 



Table 14 indicates that the MTB data base in Appendix B can be strati- 
fied by State. A more detailed examination of Appendix B indicates that 
the data can also be stratified by city, but the accident frequency becomes 
so small that it may be misleading to do so. 

Panel Member's Viewpoint 

Before the MTB data were available for the project, a panel of profes- 
sionals (see Section 2) likely to use this research product were asked to 
define the type of exposure data they would require to make hazardous 
materials routing decisions. The most significant finding was that there 
was no consensus among them. For example, some members felt they 
would require exposure information for all hazardous materials and then 
plan for the worst case. Others considered it adequate to plan for some 
type of most probable average . Still others felt that hazardous materials 
consequences were not really any more of a problem than other existing 
safety problems and preferred to deal with a single hazardous materials 
consequences factor. Taken collectively, these viewpoints suggest the 
need for a hazardous materials consequences assessment methodology 
flexible enough to accommodate this spectrum of perceived needs. As 
will be seen later in this section regarding the analysis of the MTB data, 
this data base, when supplemented with certain additional information, 
meets all the requirements set forth by the panel. 

Population and Property Exposure 

On the other hand, the panel did agree that for most practical purposes 
the primary consequence descriptors should be population and costs asso- 
ciated with the potential loss of property both on and off the right-of-way. 
The relative importance of population and property was determined by hav- 
ing the panel examine the seven classes of hazardous materials indicated 
in Table 15. Each of the seven classes was evaluated individually based 
on the potential threat it poses to people as compared with property or 
the environment. The purpose of this ranking was to determine: (1) if 
some classes of materials posed special threats to one or more of the 
three general receptor categories, and (2) the relative importance of the 
receptor categories. The factors that would suffer the consequences were 
divided into: 

. population density; 

. special populations (e.g., schools, hospitals); 

. volume of motorists (ADT); 



-62- 



TABLE 14 

HAZARDOUS MATERIALS ACCIDENT RECORDS IN THREE STATES 

(July 1973 - December 1978) 



H.M. Class 


VIRGINIA 


ALABAMA 


KANSAS 


Number 


Percent 


Number 


Percent 


Number 


Percent 




of 


of 


of 


of 


of 


of 




Accidents 


Total 


Accidents 


Total 


Accidents 


Total 


Combustible Liquid 


13 


24.1% 


15 


31.9% 


7 


20.6% 


Flammable Liquid 


31 


57.4 


23 


48.9 


20 


58.8 


Flammable Solid 





0.0 





0.0 





0.0 


Oxidizer 





0.0 


1 


2.1 


1 


2.9 


Nonflammable Gas 





0.0 





0.0 


1 


2.9 


Flammable Gas 


2 


3.7 





0.0 


1 


2.9 


Poison 


1 


1.9 


4 


8.5 


2 


5.9 


Radioactive Materials 





0.0 





0.0 





0.0 


Explosive 


1 


1.9 





0.0 





0.0 


Corrosive 


5 


9.3% 


4 


8.5% 


2 


5.9% 


TOTAL 


54 


100% 


47 


100% 


34 


100% 



SOURCE: (2) 



-63- 



TABLE 15 
HAZARDOUS MATERIALS CLASSES FOR PANEL RANKING 



HAZARDOUS MATERIAL CLASS 



EXPLOSIVES 

COMPRESSED GASES 

FLAMMABLE, COMBUSTIBLE & PYROPHORIC LIQUIDS 

POISONOUS MATERIALS & ETIOLOGIC AGENTS 

RADIOACTIVE MATERIALS 

FLAMMABLE SOLIDS, OXIDIZERS & ORGANIC 
PEROXIDES 

CORROSIVE MATERIALS 



-64- 



. bridges, ramps, and other roadway structures; 

. public and private buildings and infrastructure (power lines , 
communication lines); and 

. environmentally sensitive areas (reservoirs, waterways). 

Panelists ranked the above categories according to which would be most 
adversely affected by an accidential release of each of the seven classes of 
hazardous materials. 

People were consistently rated over the environment and property as most 
likely to suffer the worst consequences of any hazardous material release. 
Table 16 presents the distribution of receptor factors with respect to the se- 
verity of potential consequences from each class of hazardous materials. 
Summing the rating points across all classes produced the following factor 
ranks, in order of importance: population density, special populations, volume 
of motorists, environment, buildings, and bridges and ramps. 

The relatively tight cluster of factors for corrosive and flammable 
solids supports the belief that control and dispersion are the major haz- 
ardous materials considerations. Because these two classes are less 
likely to endanger as large an area as quickly, panel members apparently 
felt that measures could be taken to safeguard people; property destruc- 
tion therefore became an important segment of the overall threat. Mate- 
rials like radioactives and compressed gases, which cannot be readily 
controlled, posed such major threats to people that property damage for 
these hazardous materials classes was much less significant by compari- 
son. 

Two major findings emerged from the ranking. First, in considering 
hazardous materials routes, the most important criterion is people. (There 
was some disagreement as regards special populations versus motorists. 
The unresolved question was whether more motorists should be endangered 
to protect a school or hospital, or whether all persons should be counted 
equally.) Second, the relatively uniform ranking across all classes (i.e. , 
factors A, B, and C were always selected over D, E, and F- -except for 
corrosives) implies that from a routing consequences perspective, all hazar- 
dous materials may be considered as one class. Other findings included 
the opinion that motor carrier costs should be included as part of the con- 
sequences and that great detail in measuring the consequences was probably 
not practical for this type of analysis. 



-65- 



— M 

83 



9 X 
• V 

mi 

it 

ml V 



:e 



« • 

X w 



W b 

e • 



•5§ 

£-2 

■ 

• N 

£.2 



UhB<A 



M • 

6 s 



e u 




> 


m 


«4 


M • 




* 5 


IS 


« « 


<U Q. 


■ • 


x 


■ w 


U 


• u 


> 


ss 


X 


-* • 


4J b 


b b **. 


ft 


• 


& 9 • 


m • 


e <m 


« « 


w ■ 


•4 IH 


•e u e 


S b 


9 


e s mt 


IE: 


• • 


m u — 


H 


JJ 


3= 


u ■ e 


«* • 


u • 


»* b «M 


•rt ■ 


•e « 


X «* M 


IS 


«4 


9 B « 


u 


tm w* V 


M w 


** e 






• 


1 


1 


• u 






s& 


M 


hi 


mt 






u w 






a.** 






• "* 






u » 







< « 



M k> a 



M O 



<3J ~ 
*» 3 ■ 



m» 

i-i 


b 

5 


mt e 


8 


a ao 


• «< 




w • 


m 


• 


o 


k m 






i 


• • 


** 


miM 


o 


<M 


> 


w* • 




«u > 


1 


B • 




• X 


o 


•o 




■* • 




~s 




■ r* 




b • 




s> 




U *» 





*2 S 



i 
< 



o 
u 

b 

5 

e 



b ■ 
• b 

:s 

M U 

•O 9 
mt b 
b *J 

a • 
I 

a 



a 



a u 



m a 



as < 



m a 



B 



£a 



II 



a h 



g 

I— 

o 



8 



(A H 

a a 

M M 

9 - « 



M H 



3g 

a: g 

03 J? 

is 

o M 
g 



s 

to 
en 




(A 

> 

1-4 

w 

3 



o 

IN 



sxtaoi oMiiva 



-66- 



Analysis of the MTB and BMCS Data Bases 

Determining the magnitude of the consequences of a potential hazardous 
materials accident along a route is a function of many factors. The types of 
materials likely to be carried were indicated above, and the MTB data base 
in Appendix B shows where these accidents have taken place. Ideally, it would 
be desirable to determine the accident consequences as a function of the road- 
way factors identified in Section 2. However, this type of information is not 
a required part of the hazardous materials accident reporting procedures . 
Given that it is not possible to relate these accidents directly to consequences, 
an attempt was made to approach the problem from the perspective of the 
severity of accidents as a function of class of material, accident type, and 
varying quantities of materials spilled. 

It was possible to determine potential accident impact by class o"f mate- 
rial in terms of distances likely to be affected by the respective materials. 
This aspect is fully developed in the Range of Potential Hazardous Materials 
Impact section. However, the study of accident types and quantities spilled 
was less successful. If "type" in accident type is defined as spillage, explo- 
sion, or leakage with or without fire, then the data bases examined offer 
no help in differentiating between accidents because this information is not 
collected on MTB accident forms. If accident type is defined as head-on, 
side-swipe, rear-end accidents, etc. , it is possible to develop this infor- 
mation, but it is of little value because the quantity spilled relationship is 
not meaningful. From a consequences perspective, it may be useful to know 
the number of different accident types because rear-end collisions may spill 
more (or less) than side-swipe accidents. From this, one could hypothesize 
that more spillage results in greater consequences. However, as will be seen 
below, there is no relationship between quantity of spill and accident cost; 
therefore, knowing accident type from a consequences estimating perspective 
is not useful. 

The study next hypothesized that it may be possible to develop an acci- 
dent severity measure as a function of quantity of material spilled. The 
original concept was to develop three severity distances for each class of 
hazardous materials. The immediate distance would be the area of total 
destruction nearest the spill. The intermediate distance would extend from 
the immediate bound to the far bound and would consist of consequences 
to property defined as "heavily damaged." The far distance would extend 
from the intermediate bound to a distance of no damage and would have 
consequences to property classified as "moderate to light" damage. Con- 
ceptually, this approach could apply to population as well where the im- 
mediate distance would expose population to death, the intermediate dis- 
tance to disabling injuries, and the far distance to discomfort, evacua- 
tion, or minor injuries. Unfortunately, it was not possible to establish 
this type of relationship, as seen in Figure 7. 

-67- 




suvnoaim 



J_ii_ 



111! . 

e* •" •* «r" tt 



< 

< 
o 

en 

EB 

S 

> 

a 
u 

- B 
It 

< = 

< = 

3 © 

O H 

g^ 

< * 

X < 
U. X 

C < 

> c 

I* 






Sdvnooszei 



-68- 



Figure 7 and Appendix C are plots of amount of materials spilled from 
hazardous materials accidents versus constant dollar costs of the acci- 
dents. As these plots clearly indicate, there is no apparent relationship 
between the amount spilled at an accident site and the costs or conse- 
quences of the accident. For example. Figure 7 shows that a 100 -gallon 
fuel oil spill can have consequences as small as $100 or as great as 
$65,000. And a 6,000-gallon fuel oil accident can have consequences of 
less than $100 or more than $58,000. Similar comparisons can be made 
for the other materials plotted. The lack of relationship between amount 
spilled and consequence in cost , and the inability to relate the amount 
spilled as a result of a hazardous materials accident to the impact area, 
gave birth to the concept of measuring property and population exposed 
rather than quantifying potentials for property destroyed and people killed 
and injured. This concept will be fully developed below. 



ESTIMATING THE POTENTIAL CONSEQUENCES OF 
HAZARDOUS MATERIAL RELEASES ON HIGHWAYS 

As described in Section 2, calculating the risks associated with trans- 
porting hazardous materials on alternative highway routes requires two in- 
puts: accident probabilities, and estimates of the potential consequences on 
nearby populations and environments. The consequences component of the 
risk equation is primarily a measure of population along the route . This 
^reflects the panel's consensus that the hazardous material releases pose the 
greatest hazard to human life and then to property. The methodology uses 
census tract maps and data to estimate the number of persons potentially 
affected along a hazardous materials route . An implicit assumption in this 
approach is that residential populations accurately represent potential human 
exposure to hazardous material releases. This assumption does not consider 
the effects of time of day or the movement of commuters from home to work 
place; however, these limitations were judged less severe than the complexi- 
ties of an analysis which did account for travel behavior and, if desired, such 
analyses could be undertaken with this methodology. 

Other factors in the consequences component include the location of spec- 
ial populations (e.g., schools, hospitals, etc.), the value of private property 
along the roadway, and the value of nearby public property including road- 
way structures. These factors need not be treated in a quantitative manner, 
like population, but may be used as qualitative influences to subjectively pri- 
oritize alternatives that show no clear-cut differences according to their 
population risk values. (These factors can be treated quantitatively by esti- 
mating the value of the various properties and structures . The data re- 
quirements for this exercise are prohibitive, however, and it is not clear 



-69- 



that the expense is warranted in light of the secondary importance of pro- 
perty as a consequence factor and the fact that the degree to which the pro- 
perty would be destroyed is unknown.) 

Range of Potential Hazardous Materials Impacts 

The potential effects of a hazardous material release depend on the type 
and amount of the commodity spilled and the environment in which it spills . 
Due to the wide variation in chemical properties of hazardous materials, 
the different commodities were grouped by placard class and a potential 
impact area assigned to each hazardous materials placard class on the basis 
of the recommended evacuation distance in the Hazardous Materials Emergency 
Response Guide currently being prepared for the USDOT (3). Essentially, 
the guide recommends minimum safe evacuation distances for commodities 
likely to be poisonous, corrosive, explosive, etc. Table 17 presents the 
potential impact area by hazardous materials placard class . The impact area 
for each class represents the recommended evacuation distance for that com- 
modity within the class with the largest evacuation distance. Only commodities 
which had been in vehicular accidents between July 1973 and December 1978 
(and were reported to MTB) were considered. 

The study approach is based on the worst case commodity for each class. 
This was a subjective decision which uses the most conservative (or worst 
case) situation for planning purposes. In some instances, the worst case may 
not be representative of the commodities most commonly transported within 
that class. The methodology permits the analyst to substitute his own values 
for the impact distances or use recommended evacuation distances for com- 
modities that more accurately reflect hazardous materials movements within 
his area. 

Estimating Population Within the Potential Impact Area 

The primary measure for estimating potential consequences is popula- 
tion. To estimate the potentially exposed population along a hazardous mate- 
rials route for a specific hazardous materials class, the class impact dis- 
tances on both sides of the right-of-way are delineated on census maps and 
that share of the total tract population falling within the impact zone is 
recorded. This procedure is detailed below. 

(1) Compile Census Tract Maps, Identify Routes, and Mark Off Zone of 
Impacts 

Census tract maps show tract boundaries in an SMSA and are available 
from the Department of Commerce » Bureau of the Census . As only the 
boundaries of the census tracts are shown on these maps, it may be neces- 
sary to draw in portions of the alternative hazardous materials routes . 
(See Figure 8 for example of a tract map.) 

-70- 



1 



u 

ft- 



s 



I 

3 



£ 



3 



o 

flu 

















a» 




• 












o 




| 




■o 

1 
















^■Mk 




_f- u 












I 




E 




E 

S 




(0 


(0 


<o 


o» 


a 


M 


IA 

• 

3, 


0» 






e 
o 


e 
o 


e 
o 


| 


• 

1 


| 


I 


e 
o 


E 




35 






33 




•» 


<•* 


33 






U 


o 


o 


O 


CM 


O 


• 


i 

TO 


r-» 


2 






i 


S 

5 


X 
• 




o 

X 


d 

K 


fit 


^ 


K 


^ 


mm 


■o 


^m 


• 




a» 


< 


"5 


« 


"5 


• 


i 


• 


i 


« 


e 
o 


o 


? 


? 


? 


f 


? 


£ 




? 


«w 


< 


j* 


J* 


jc 


j^ 


S 


E* 


jg 


E 


Q. 

s 


00 

• 

3 

• 


to 
3 


3 


00 

• 

3 

• 


• 
CM, 


oe 

3 

m 


CO 

■ 

St 


ao 

• 

3 


00 

3 




I 
U> 


E 


E 

IA 


I 

u> 


■ 

E 

CO 


I 
IA 


• 

E 


E 

IA 

• 


I 




d 


d 


d 


d 


• 

■o 

e 

i 

e 


d 


CM 

d 

e 

* 

e 

1 

a 


O 


IA 

d 

c 

1 

c 

* 

o 
o 












«• 




















01 






. 














O 


01 








o 










5 


• 

a 








, 










a 


01 








z 
I 


3 
• 


3 

Zi 


•o 

1 




§ 

a 

i 


e 

a 

E 
o 
o 










3 

35 


• 
2 


• 




• 
E 


• 




0) 

s 


S 




0» 


« 


« 


in 


E 


m 




> 


> 




3 


E 


E 


s 


« 


E 


§ 


8 


1 

o 




E 

o 


E 


E 

• 


5 


1 


E 


0» 

o 


1 




o 


u. 


E 


o 


z 


ul 


at 


o 



o 

CO 

a. 
E 



o 
a 



c 
o 



i 

o 

c 

o 

o 

J5 
« 
o 

• 

3 

r 

03 
XL 
U 

0> 



■o 
• 

3 

o 

c 

o 
c 

s 

« 

"5 

• 

OB 



I 

O 

« 

o 



S3 S 

AC c « 



-71- 



After the alternative routes are identified, the zone of potential impacts 
is delineated on the tract maps . For each pertinent hazardous materials 
class there is an associated impact distance, and this value is scaled to 
the map and marked off on both sides of the route. The resultant impact 
zone is a corridor described by two parallel lines on each side of the route, 
as illustrated in Figure 8 , for flammable liquids . 

(2) Measure Share of Census Tract Which Falls Within Impact Zone 

With the exception of tracts lying wholly within the impact zone , it is 
necessary to measure or estimate the share of a tract that falls within the 
impact zone boundaries. After estimating the share (or percentage) of the 
tract within the zone , this percentage is multiplied by the total tract popu- 
lation to estimate the number of people in that tract living within the poten- 
tial impact area. This approach assumes that the population within each 
census tract is evenly distributed- -an assumption that can be refined with 
local knowledge. 

There are two methods to determine what percentage of a tract lies with- 
in the impact zone boundaries: (1) estimate, and (2) measure. The level 
of precision desired for the alternatives analysis will indicate which tech- 
nique is appropriate. Measurements may be made with a planimeter, a 
small drafting instrument that measures surface area from maps. 

The percentage of tract lying within the impact zone is recorded in column 
4 of Worksheet 2 (Table 18). Note that each road segment will typically con- 
tain several tracts, and it will be much easier to associate discrete tracts 
and road segments if the routes were originally segmented with the tract 
boundaries in mind. (This issue was discussed in Section 2 in the subsection 
"Identify Alternatives and Segment Routes.") 

(3) Look Up Tract Populations and Determine Share of Tract Population 
in Impact Zone 

Population from each tract is found in the U.S. Census and recorded on 
Worksheet 2 in column 3. The product of columns 3 and 4 produces the im- 
pact area population for each tract (column 5). Summing across all tract 
population shares for a segment gives the total segment population in the 
potential impact area. 

(4) Record Locations of Special Populations (Optional) 

This part of the process relies on subjective judgments regarding which 
populations or special groups should receive added weight in the evaluation 



-72- 




FIGURE 8: CENSUS TRACT MAP AND HAZARDOUS MATERIALS IMPACT ZONE 



-73- 



Alternative: . 
Date: 



TABLE 18 

WORKSHEET 2: POPULATION INVENTORY 



H.M. Class: 



Page of. 



Impact Radius:. 



SEGMENT 



OfO 



CENSUS TRACTS 



NUMBER 



POPULATION 



£ PERCENT OF TRACT J_ POPULATION IN 
* -I IN IMPACT AREA IMPACT AREA 



r^t 



SPECIAL 
POPULATIONS 



T7 



-74- 



criteria. This study does not recommend any particular group or institu- 
tion but merely acknowledges that some communities may wish to include 
this factor in their analysis. 

Two obvious candidates for the special groups category are schools and 
hospitals. The USGS maps identify the locations of these facilities; persons 
familiar with the area will, of course, also possess this knowledge. Column 
6 on Worksheet 2 has been provided to record these items. The enumeration 
of special populations is not directly used in the risk calculations but 
may be useful as an alternatives tie-breaker or to provide a more compre- 
hensive picture of the impact area. 

(5) Inventory Property on a Hazardous Materials Route 

In addition to personal liability, hazardous material releases threaten 
structures on or adjacent to the right-of-way. Structures include public prop- 
erty such as bridges and overpasses, as well as private property such as 
homes and commercial developments. The level of sophistication of the prop- 
erty inventory depends on the amount of resources a community chooses to 
allocate for this part of the analysis. Property inventory techniques range 
from simple enumerations from secondary data sources (like the special 
populations inventory) to quantitative estimates that may be used in property 
risk calculations. When choosing the appropriate technique, the analyst must 
trade-off varying levels of precision with the costs of achieving that precision 
and the importance of the property component in the overall alternatives 
analysis. The technique chosen to inventory property should reflect the cri- 
teria and criteria weights that will ultimately be used in the alternatives 
analysis. Some communities may regard population risk as the overriding 
measure of importance and treat property risk as merely an ancillary rather 
than decisive factor. Other communities may feel that property measures 
should be quantified as much as possible to ensure an objective and uniformly 
applied alternatives analysis. 

Only structures on the roadway (e.g., bridges and overpasses) and the 
lineal frontage of buildings adjacent to the roadway are measured in the prop- 
erty inventory. Unlike the population inventory, in which impacts are esti- 
mated for an area, the study confines estimates of potential property damage 
to the right-of-way and its immediate environs. This approach was adopted 
largely because of a lack of historical data for developing impact radii for 
potential hazardous materials property damage. Also, for materials like 
combustibles and explosives, much of the property damage is likely to be 
concentrated on the adjacent buildings, which in turn act as buffers for the 
ones behind them. Therefore, the conceptualized potential range of impacts 
for property is in one dimension rather than two. A paucity of data also 



-75- 



precludes differentiating potential impacts between the hazardous materials 
classes in any more than a cursory fashion; the hazardous materials classes 
have thus been grouped for the property impact inventory. 

The following discussion presents three techniques for measuring the 
types and amount of property along a hazardous materials route. The tech- 
niques are presented in ascending order of sophistication (and cost), and 
the third technique will enable the analyst to develop numerical property 
values that can be used in property risk calculations . 

The easiest method for determining the types and amounts of property 
along the hazardous materials route is to measure the lineal frontage of the 
various land uses from land-use maps. Worksheet 3 (Table 19) stratifies 
land-use types into the following five categories: 

. low-density residential; 

. medium-density residential; 

. high-density residential; 

. commercial; 

. industrial; and 

. public . 

Land-use maps--usually available from city, county, or regional planning 
agencies- -can be used to obtain this information. Roadway structures may 
be inventoried with the aid of highly detailed road maps , traffic engineer- 
ing maps from local or State transportation departments, or aerial photo- 
graphs . 

The second level of roadway inventory would be field data collection to 
validate and refine the measurements made from the land-use maps. In this 
exercise, the analyst would travel along each alternative route and measure, 
by means of odometer readings, the length of each property type developed 



*Some communities may have the necessary information to measure the im- 
pact area along two dimensions. For example, a munitions plant shipping 
truckloads of explosives may know the radius of property impacts in the 
event of an explosion. With this knowledge, the methodology described 
above in population impacts can be adapted to property impacts, and the 
data collection techniques described below modified accordingly. 



-76- 



Alternative: . 
Date: 



TABLE 19 

WORKSHEET 3: PROPERTY INVENTORY 



H.M. Class: . 



Page of 



Impact Radius; . 



SEGMENT 



UNO USE (mile Irwrtini railway) 



O/O 



HI-DENSITT 

RESIO. 



MD-DENSITY 
RESID. 



LOW-DENSITY 
RESID. 



PUBLIC 



COMMERCIAL INDUSTRIAL 



NUMBER OF ROADWAY 
STRUCTURES 



BRIDGE 



OVERPASS 



SPECIAL 
PROPERTIES 



-77- 



and actually fronting the roadway. This procedure provides a more realis- 
tic measure of what will actually be exposed, compared with the land-use 
maps which often do not identify individual properties (or their proximity to 
the road) within the areas designated commercial, industrial, residential, 
etc . Field observations of the roadway structures may also provide a better 
picture of the size and nature of bridges, overpasses, cloverleafs, etc. 

The third inventory technique builds upon the previous two and is designed 
to generate estimates of the dollar values for the property located along the 
route. While in the field, observations are made of specific, representative 
properties within each land-use type. These properties are then located in 
the tax assessor's records, and an assessed value per linear foot of front- 
age is computed. The dollar per running foot value for each land-use type 
is then multiplied by the corresponding amount of actual land use observed 
along the route. Similarly, bridge and overpass structure values are ob- 
tained from the State highway department, and the total value of these struc- 
tures is computed. Although this technique is admittedly crude, any biases 
introduced are uniform across all routes, and the relative (rather than the 
absolute) values should be consistent for the risk computations. 



CONSEQUENCE METHODOLOGY APPLIED TO 
WASHINGTON, D.C., CASE STUDY 

For purposes of the Washington, D.C. , case study, the hazardous mate- 
rials class of flammable liquids was chosen for the impact evaluation. Flam- 
mable liquids have a potential impact distance of 0.5 miles (0.8 km) in all 
directions, and this distance is also applicable for combustible liquids, flam- 
mable solids, oxidizers, flammable compressed gas, and explosives. Flam- 
mable liquids were also chosen because this class includes gasoline, and the 
study was concerned with the potential impacts of the most frequently trans- 
ported commodity. The following discussion presents the steps and findings 
from applying the impact estimation methodology in Washington. The work- 
sheets used to compile potential impact data on Alternative 1 are presented 
as examples. The worksheets used for the other alternatives may be found 
in Appendix E. 

(1) Compile Census Tract Maps, Identify Routes and Mark Off Zone 
of Impacts 

Figure 9 identifies the four alternative routes and their associated im- 
pact zones delineated on census tract maps . The census tract maps for the 



-78- 




z 
o 

N 
H 

0* 



P 
CO 

H 

O 

OS 

w 

z 

as 

H 

< 



o 



-79- 



Washington, D.C. , SMSA were obtained from the U.S. Department of Com- 
merce. The parallel lines around each route represent a corridor approx- 
imately one mile (1.6 km) wide. This corridor is the sum of the potential 
impact distances in either direction from the right-of-way. 

(2) Measure Share of Census Tract Which Falls Within Impact Zone 

The share of each census tract falling within the impact zone was deter- 
mined by measuring the area with a planimeter. Table 20 presents the 
worksheets for Alternative 1 . 

(3) Look Up Tract Populations and Determine Share of Tract Popula - 
tion in Impact Zone 

The total population for each census tract within the zone was found in 
the U.S. Census of Housing and Population and recorded in column 3 of 
Worksheet 2 . Those tracts not wholly within the zone were then multiplied 
by the percentage factor in column 4 to determine the number of potentially 
exposed persons in that tract. After values were derived for each tract, 
all the tracts in each segment were summed to get a population value for 
the segment. The total segment population is a function of the length of 
the segment and the nearby residential density. 

The results of the population inventory are presented in Figure 10. The 
route segments correspond to the segments used in the probability calcula- 
tions, and multiplying the accident probabilities by the population produces 
risk values for each segment. 

(4) Record Locations of Special Populations (Optional) 

Only schools were designated "special populations" for purposes of the 
case study. Some segments of Alternative 1 have large concentrations of 
schools, and there are 22 schools along the entire route. 

(5) Inventory Property on Hazardous Materials Route 

The property along the alternative hazardous materials routes was inven- 
toried by using land-use maps and then refining these measures with a "drive- 
by" inspection. The results of these observations for Alternative 1 are pre- 
sented in Table 21 on Worksheet 3. The property exposure values developed 
from the land-use maps are followed in each cell by a number in parentheses. 
The bracketed value is the amount of property that was visible from the road- 
way, or generally the amount of development that might experience some dam- 
age resulting from a hazardous material release. 



•80- 



Alternative: . 
Oate: 



TABLE 20 

WORKSHEET 2: WASHINGTON, D.C. 
POPULATION INVENTORY 



H.M. Class Flammable L iquid 



Page_bfJL 



Impact Radius: 



.5 mile (.8km) 





1 


2 


3 


4 


s 


6 


SEGMENT 


CENSUS TRACTS 


SPECIAL 
POPULATIONS 


rr 


OIO 


NUMBER 


POPULATION ) 


PERCENT Of TRACT 
( IN IMPACT AREA 


POPULATION IN 
IMPACT AREA 


1-A 


From 1-395 
and 1-495 

To Tele- 
graph Rd. 

TOTAL 


4014 


3734 


.47 


1755 


8 schools 


4036 


3396 


.10 


340 


4015 


2689 


.81 


2178 


4016 


4941 


.73 


3607 


4017 


4274 


.13 


556 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


8436 


1-B 


To Rte. 1 


4018 


4127 


.28 


1156 


3 schools 


4019 


5559 


.79 


4392 


2007 


1749 


.22 


385 


2020.02 


3115 


.88 


2741 


2017 


1292 


.11 


142 


4002 


4622 


.05 


231 


TOTAL 


XXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


9047 


L-C 


To: Indian 
Head Hwy. 


8014.03 


2944 


.20 


589 


1 school 

i 


8014.04 


3102 


.14 


434 


TOTAL 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


1023 


L-D 




8014.05 


5139 


.49 


2518 


! 
6 schools 


8015 


3585 


.36 


1291 


8017.03 


10289 


.59 


6071 


8014.02 


3748 


.05 


187 


8017.02 


2784 


.93 


2589 


8017.01 


5976 


.05 


299 


8017.05 


3742 


.05 


187 


8019.02 


630 


.17 


107- 



-81- 



Alternative: L 

Date: 



TABLE 20 (Continued) 



Page_lof-2_ 



H.M. Class; Flammable L iquid 
Impact Radim: -5 mile (.8km) 

6 



SEGMENT 


CENSUS TRACTS 


SPECIAL 
POPULATIONS 


# 


0(0 


NUMBER 


POPULATION ) 


PERCENT OF TRACT . 
C IN IMPACT AREA 


POPULATION IN 
IMPACT AREA 


1-D 
(co 


it'd) 

To 
Pennsylva- 
lia Avenue 


8,019.01 


6,453 


.33 


2,129 




8,019.03 


7,089 


.43 


3,048 


8,019.04 


4,116 


.44 


1,811 


8.011.02 


6.418 


.07 


449 


8,021.01 


5,155 


.27 


1,392 


TOTAL 


XXXXXXXX 


XXXXXXXXXX 


XXXXXXXXXXX 


22,078 


1-E 


To: 1-495 
and Rte. 
50 


8,022.02 


9,789 


.19 


1,860 


4 schools 


8,022.01 


669 


.43 


288 


ES: 


'IMATED AREA 




12,092 


8,028.02 


7,291 


.12 


875 


8,035.02 


1,653 


.24 


397 


8,035.03 


7,735 


.26 


2,011 


8,036.02 


4,487 


.31 


1,391 


8,036.01 


2,493 


.44 


1,097 


8,036.08 


5,597 


.05 


28Q 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXXXX 


20,291 









































































-82- 




o 

H 
Z 



z 

o 

H 



Dm 

o 

ft. 



-83- 



Alternative. 

DltK 



TABLE 21 

WORKSHEET 3: WASHINGTON, D.C. 
PROPERTY INVENTORY 



Pag«-Aof_J_ 



H.M. Ci tr Flammable Li quid 
Impact Radius; .5 mile (. 8km) 



SEGMENT 


UNO USE (mita frsntiiif nadmrl 


NUMBER OF ROAOVtAY 
STRUCTURES 


SPECIAL 
PROPERTIES 


# 


0/0 


HI-OENSITT 
RESIO. 


MO-OENSITT 
RESIO. 


UWM1ENSITY 
RESIO. 


PUBLIC 


COMMERCIAL 


INDUSTRIAL 


8RI06E 


OVERPASS 


1-A 






2.1 


1.7 




0.5(0.4) 


2.1 


(3) 


1 




1-B 




0.1 


0.8 






0.3(0.1) 


0.7(0.2) 


(1) 


(2) 


Sewage 

Treatment 

Plant 


1-C 






0.8(0.2) 






0.2(0.1) 




(1) 


(3) 


Woodrow 

Wilson 

Bridge 


1-D 




(0.1) 


4.5 


6.4(0.3) 


1.5(1.0) 


0.2(0.1) 




(2) 


(1) 




1-E 






5.0 


2.3 






2.0 


(2) 


(5) 


































































































- 

















Note: Values in parentheses are observations made during a "drive-by" inspection 
and represent our best judgement as to the land-use type. The other cell 
entries were developed from land-use maps. 



-84- 



The number of bridges and overpasses along the alternative routes was 
also recorded. The Woodrow Wilson Bridge across the Potomac River, 
for example, is a very large structure serving high volumes of traffic which, 
if interrupted, would have serious ramifications for the regional transporta- 
tion system. Alternative 3 includes numerous overpasses and bridges around 
the Pentagon area and, like the Woodrow Wilson Bridge, it would pose seri- 
ous problems for commuters if the roadway had to be closed. 

(6) Inventory Special Property 

Alternative 4 would route a hazardous materials carrier past the most 
significant special property on all of the potential routes- -the U.S. Capitol. 
Alternative 2 exposes the Blue Plains sewage treatment plant. This major 
waste water treatment facility is situated right next to the roadway and a 
hazardous materials release of highly explosive materials might result in 
temporary disruption of service. 

SUMMARY 

This section presented the methodology for estimating the potential im- 
pacts of a hazardous material release on nearby populations and property. 
Although the impact calculations depend on the class of material transported, 
several of the classes use the same impact parameters and therefore produce 
the same consequence values. The methodology uses readily available data 
and may be performed with varying levels of precision, depending on the 
level of effort the performing agency wishes to expend. 

The population consequence values calculated in the Washington, D.C. , 
case study demonstrate greater variation than the corresponding probability 
values. This is due to the range of development activities in the metropolitan 
area which includes the densely populated Shirley Highway corridor and the 
relatively undeveloped Prince George's County. Section 4 will explain how 
to combine the probability and consequence values to produce estimates of 
risk. Subjective criteria which may be used to modify the objective risk 
calculations will also be discussed in Section 4. 



-85- 



REFERENCES 



1. Dennis Price and J.W. Schmidt; "Virginia Highway Hazardous Materials 
Flow: 1977 Survey," Virginia Polytechnic Institute and State University 
for the Virginia Department of Transportation Safety, Richmond, Vir- 
ginia (undated). 

2. From a printout (dated October 11, 1979) of the traffic accidents in the 
MTB data base for the period July 1973 to December 1978. 

3. Chemical Propulsion Information Agency, "Hazardous Materials Emer- 
gency Response Guide," unpublished draft, prepared for the USDOT 
Research and Special Programs Administration, prepared at the Johns 
Hopkins University Applied Physics Laboratory, 1979. 

4. Price, Dennis L. , "Ten Most Critical Issues in Hazardous Materials 
Transportation," Report from A3C10 Committee, Transportation Re- 
search Board, National Research Council, 1979. 

5. Federal Motor Carrier Safety Regulations, U.S. Department of Trans- 
portation, Federal Highway Administration, CFR parts 390-397, com- 
pilation issued by the American Trucking Association, Washington, 
D.C., 1979. 



-86- 



4. DEVELOPMENT OF A HAZARDOUS MATERIALS 
RISK ASSESSMENT METHODOLOGY 
FOR EVALUATING ALTERNATE ROUTES 



OVERVIEW OF RISK ASSESSMENT METHODOLOGY 

The risk assessment methodology developed to evaluate alternate routes 
for transporting hazardous materials over highways consists of three levels 
of decision making. At the first level, the specific criteria for determining 
a particular route's applicability are legalistic and mandatory variables. In 
general, these consist of existing laws, physical roadway limitations, or other 
factors that may preclude the route's use. The second level involves calcu- 
lating numeric risk values, as described in Sections 2 and 3. The third and 
final level is optional; that is, if the numeric risk difference among the candi- 
date routes is too small for making the route selection decision, then other 
qualitative and quantitative criteria are used. These criteria include: calcu- 
lating the difference in time and travel costs to the motor carrier; comparing 
different land uses; evaluating the difference in response capability and proxi- 
mity of fire and rescue; noting the difference in number of highway structures; 
identifying special populations such as schools , hospitals , and senior citizen 
homes; and others. Each of the criteria levels is further discussed below. 



CRITERIA FOR DESIGNATING HIGHWAY ROUTES 
FOR TRANSPORTING HAZARDOUS MATERIALS 

The criteria described here should generally be followed in the order pre- 
sented. This discussion assumes that an agency, group of agencies, or some 
organization has been designated or has taken the responsibility to perform 
an analysis of the routes used to transport hazardous materials. The criteria 
can be used either to establish routes or examine existing routes, by simply 
omitting certain criteria steps for the latter analysis. Local distribution 
routes or through routes for hazardous materials can be examined, but the 
former are much more involved and may take the form of exception routes. 
That is, for local distribution it may not be possible or practical to designate 
routes, but it will make more sense to exclude hazardous materials transport 
from certain routes or certain areas of the city. The criteria are flexible 
enough to accommodate all local information available, but at the same time 
provide default data for jurisdictions that may not have the necessary evalua- 
tive information. Finally, the criteria are presented in a documentary rather 
than a users' format so that FHWA will be able to document the research 
accomplished under this contract. It is anticipated that a companion users' 
document will be developed for the application of these procedures. 



-87- 



Mandatory Factors 

Mandatory Factors, Criterion 1 

This criterion level consists of factors pertaining to the physical features 
of the routes. A determination will have to be made regarding the ability of 
the route to carry the commodities. Bridge carrying capacity, tunnel and 
bridge clearance heights, and turning radii are all physical factors that must 
be investigated. For most major roads these factors will not apply; however, 
drivers on these routes should be capable of making such determinations, 
or first-hand observations should be made to ensure that the routes can ac- 
commodate vehicles carrying hazardous materials . 

Mandatory Factors, Criterion 2 

Legal and jurisdictional searches are performed at this level. That is, 
laws, agreements, ordinances, and other legal instruments are searched at 
the local, State, regional, or interregional level to determine if they specifi- 
cally preclude the use of any routes that may be considered in the analysis. 
At the local level the usual source of this type of information is the city at- 
torney, fire department, or police department- -although this may vary from 
location to location. 

Another legal aspect that should not be overlooked is jurisdictional author- 
ity. That is, it should be determined which agency or group of agencies has 
the authority to enact legal instruments to designate a route for the transport 
of hazardous materials. Legal jurisdiction is probably the most important 
criterion for designating a lead agency. The objectives of the routing analysis 
will largely determine whose jurisdiction is affected. If the objective is to 
route through hazardous materials shipments, the lead agency must be re- 
sponsible for regional transportation activities in order to coordinate route 
selection through more than one local government's jurisdiction. For local 
deliveries, the lead agency need not have regional jurisdiction but should be 
cognizant of the pattern of hazardous materials movements within the area. 
Regional coordination is an essential part of the route designation process to 
forestall the designation of routes that are largely untenable. For example, 
a community would likely encounter stiff opposition from hazardous materials 
carriers if it enacted ordinances requiring carriers to use highly circuitous 
routes in order to enter the city limits through only one access route. 



As indicated in Section 2, the alternative should be included in the analysis 
even if there is a legal mandate precluding its use . 

-88- 



Variable Factors 

Variable factor analysis consists of making numeric risk comparisons 
among the alternate routes available for hazardous materials transport. Risk, 
as previously defined, is the product of the probability of a hazardous mate- 
rials accident and the consequences associated with the accident. This section 
presents the criteria by which the risk associated with the transport of hazard- 
ous materials on highways can be quantified. 

Variable Factors, Criterion 1 

Determining what materials are carried through and used in an area is the 
first step at this level. This involves first having a knowledge of which hazard- 
ous materials are to be considered and then deciding which hazardous mate- 
rials to use in the risk analysis. It is difficult, if not impossible, to determine 
accurately which hazardous materials travel into and through an area because 
of the lack of published information in this regard. Rather, the planner must 
rely on: local knowledge; observation; and police, fire, and other local expe- 
rience to determine which hazardous materials are appropriate for consider- 
ation. For example, all areas use chlorine in their water works and gasoline 
in service stations. However, the quantities used are a function of the size 
of the study area. An examination of the U.S. Census of Manufacturing for 
an area would suggest other hazardous materials, as would discussions with 
community leaders and other professionals. 

Alternatively, Appendix B--the MTB data base of roadway accidents from 
July 1973 to December 1978--can be used as a default indicator of the types 
of hazardous materials transported in an area. If this default information is 
used, it is recommended that it be at the State level and that, where possible, 
a summary be made of the surrounding States as well. 

Once the local list of hazardous materials is developed, a decision must 
be made regarding which material or group of materials will be used in the 
analysis. Some agencies may wish to plan for the worst case commodity car- 
ried in their area or the worst case commodity transported nationally. Others 
may want to perform the analysis for each commodity, derive a weighted aver- 
age, or develop their own distances based on frequency of carriage. Whatever 
method is selected, it must produce exposure distance or distances that will 
permit the population calculations in the next step. 

Variable Factors, Criterion 2 

This step consists of determining the risk associated with each route for 
the respective hazardous material carried, in order to choose the route found 
to have the least risk based on the methodology presented in Sections 2 and ,3. 



-89 



If the risk is clearly less on one route, then the analysis is complete. How- 
ever, if the risk values are similar, say within 10 to 25 percent of one 
another, then the third level of analysis should be undertaken. Local proce- 
dures may dictate that the risk threshold for using the subjective criteria be 
even greater. 

Subjective Factors Criteria 

The degree to which subjective factor analysis is completed is decided by 
the professional judgment of those accomplishing the alternatives analysis. 
The primary purpose of this discussion is to lend support to the variable fac- 
tors analysis. Two analyses that have been identified as subjective criteria are: 
developing a comparison of the motor carrier's time and travel costs for each 
route; and evaluating the difference in response capability. The time and costs 
comparison should be calculated with the cooperation of local carriers, in an 
effort to capture the latest fuel costs. The analysis of the difference in re- 
sponse capability should determine the proximity and capability of a hazard- 
ous materials accident suppression. To make the proximity determination, 
it is sufficient to identify and discuss with fire personnel the proximity of all 
fire stations to each of the routes on a map. To make the capability deter- 
mination, it is necessary to assess each fire station's ability regarding level 
of training for the type of hazardous material carried in the area under study. 
This assessment consists of comparing the hazardous material carried in the 
local area to those listed in Appendix F. For each material found in Appendix 
F, an assessment must be made regarding the response capability. That is, 
full-time professional fire fighters are more likely to recognize a placard 
and provide the proper agent to extinguish a chemical fire; whereas volun- 
teer or poorly trained personnel are more likely to simply flood the chemical 
fire with water, which may make certain chemical fires worse. Accordingly, 
for each locally transported chemical listed in Appendix F that requires a 
suppression agent other than water, the planner should consult with fire per- 
sonnel to determine how they would likely respond. Those fire stations that 
have better training should be noted along each route, as should those with 
less training. The implication is that better trained fire personnel are more 
likely to mitigate a spill properly and thereby make the route safer. 

Another subjective criterion analysis is comparing the number of highway 
structures. An enumeration of highway bridges, tunnels, and underpasses 
should be made for each route. Any particularly sensitive structures with 
respect to size or location should be noted. The objective here is to suggest 
that an accident on a route with fewer structures will have less severe conse- 
quences . 

Another analysis in this category is identifying and enumerating special 
populations. This criterio.i involves making comparisons of the number of 



-90- 



special population centers such as schools, hospitals, and senior citizen homes 
within the exposure zone. The route with the fewest of these facilities would 
be the most desirable one. 

Other criteria can also be developed and used in this analysis, including: 
ecologically sensitive areas; proximity of utilities (water, power, or com- 
munications facilities); ambient environmental characteristics; water shed 
locations; and general meteorological conditions. These and other criteria 
are usually site-specific and, accordingly, their development is left to the 
local agency. The following discussion illustrates the application of these 
criteria in the Washington, D.C., case study. 



RISK METHODOLOGY APPLIED TO 
WASHINGTON, D.C., CASE STUDY 

Introduction 

The first questions to be answered in evaluating alternative hazardous mate- 
rials routes are: who should perform the analysis, who should be informed 
of it and coordinated with, and who should implement the recommendations? 
The choice of an appropriate performing agency will depend on legal juris- 
dictions, familiarity with hazardous materials movements, and staff capa- 
bility. In the Washington, D.C., hypothetical case study, the appropriate 
agency would be the Washington Council of Governments (WASHCOG). The 
choice of coordinating and implementing agencies will vary from area to area. 
Since the objective of the case study is to designate through routes, the re- 
sponsible agency must have jurisdiction in the three areas involved: Virginia, 
Maryland, and the District of Columbia. The following discussion presents 
the results of the case study and illustrates the use of the proposed criteria 
for designating hazardous materials routes. 

Mandatory Factors 

Within the metropolitan Washington area, several roadways prohibit truck 
traffic because of clearance height and weight limitations. The George Wash- 
ington and Baltimore-Washington Parkways are two examples of routes that 
would be excluded on the basis of mandatory factors . 

Another mandatory factor affecting route selection is a District of Columbia 
ordinance which prohibits hazardous cargoes in the Mall Tunnel on 1-95 near 
the U.S. Capitol. The District has designated a hazardous cargo, route which 
diverts hazardous materials carriers away from the tunnel and 1-95. However, 
this route is not precluded from the analysis because the legal reasons may 
not necessarily involve least risk. 



-91- 



Variable Factors 

Probability Calculations 

Accident rates are used in this part of the analysis to determine which 
of the alternative routes has the greatest likelihood of an accident occurring. 
As discussed in Section 2, interstate highways have better safety records, as 
compared with highways without controlled access such as urban arterials. 
Accident rates for the alternative routes in the case study were estimated 
by using the predictive models described in Section 2. (Use of the interstate 
predictive model was illustrated earlier for Alternative 1 in Table 11 of Sec- 
tion 2.) The accident rates are converted into probability statements by 
multiplying the segment accident rate by its length (or exposure). The prob- 
ability values for all of the alternatives are presented in Appendix D. 

Consequence Calculations 

In order to apply the consequence methodology to the case study, it was 
necessary to select a hazardous materials class to be evaluated. The risk 
methodology calculates potential hazardous materials impacts on the basis of 
the range of influence that can be associated with a particular class of mate- 
rials. 

Flammable liquids was selected as the case study hazardous materials 
class for several reasons. First, gasoline is a commodity within this class, 
and the case study was designed to illustrate likely conditions. The Virginia 
survey of trucks revealed a high incidence of flammable liquids carriers within 
the truck traffic stream (see Table 13 p. 61). Another contributing factor was that 
the range of impacts for gasoline- -0.5 miles (0.8 km)- -was representative of 
several hazardous materials classes, including: combustible liquids, flam- 
mable solids, oxidizers, flammable compressed gas, and explosives (see 
Table 17 p. 71). Lastly, flammable liquids represent the hazardous materials 
class most commonly involved in accidents, as recorded by the MTB (see 
Table 13 p. 61). 

The number of persons living within a half-mile (0.8 km) radius along 
the four alternative routes was measured using census tract maps and data. 
Property was inventoried along these routes, but estimates of the value of the 
property were not made. The calculations for these analyses are presented 
in Appendix E. Each of the route segments has an associated population esti- 
mate and inventory of property. Alternative 4 has the largest number of per- 
sons (116,565) living within its zone of impacts, followed by Alternative 3 



In general, interstate highways have fewer total accidents than urban arterials 
per million vehicle-miles. Fatal and injury-producing accident rates may be 
comparable, however. 

-92- 



(114,890), Alternative 2 (81,083), and Alternative 1 (60,875). The number 
of roadway structures along each of the alternatives shows a similar rela- 
tionship, as illustrated in Table 22. 



TABLE 22 



HIGHWAY STRUCTURES ON THE FOUR ALTERNATIVES 





Number of 


Number of 


Alternative 


Bridges 


Overpasses 


1 


9 


12 


2 


12 


15 


3 


26 


37 


4 


25 


37 



Population Risk Calculations 

After the accident probabilities and population values have been determined 
for each segment on the alternative routes, the information is transferred to 
Worksheet 4. Table 23 presents the risk calculations for Alternative 1; risk 
calculations for the other alternatives are presented in Appendix G. 

Column 3 on Worksheet 4 is a constant which represents the probability of 
a hazardous materials vehicle being involved in an accident given that a vehicu- 
lar accident occurs. This probability is the ratio of hazardous materials ac- 
cidents to all accidents during the years 1973 to 1978. There were 93.2 mil- 
lion accidents involving all vehicles during this period (1), and 2,104 involving 
hazardous materials carriers- -for a ratio of 2.3 x 10 to one. The product 
of column 2 (probability of any vehicle accident) times column 3 (incidence of 
hazardous materials vehicle accidents) is the probability of a hazardous mate- 
rials vehicle accident occurring. 



-93- 



Alternative: L 

Oatc 



Pag«J.of_L_ 



TABLE 23 



WORKSHEET 4: POPULATION RISK CALCULATIONS 






H.M. n«g Flammable L iquid 
Impact Radius; , S mi 1 p 



1 


2 


3 


4 


5 


6 


SEGMENT 


■ 1 

nm vehicu acq y 


/ H.M. ACCIDENT J 
V INCIDENCE FACTO* ~~ 


"1 

Z P(HJ*. YEH. ACC.) y 


/ SEGMENT J 
^ POPULATION — 


SEGMENT 
- POPULATION 
RISK 


1-A 


7.575 X 10" 6 


13 1 10 | •* 


1.742 x 10" 10 


8436 


1.470 x 10~ 6 


1-B 


1.949 x 10" 6 


if 


4.483 x 10~ U 


9047 


4.056 x 10~ 7 


1-C 


4.842 x 10~ 6 


».» 


1.114 x 10" 10 


1023 


1.140 x 10~ 7 


1-D 


9.184 x 10" 6 


11 


2.112 x 10~ 10 


22078 


4.663 x 10" 6 


1-H 


11.810 * 10~ 6 


it 


2.721 x 10~ 10 


20291 


5.521 x 10* 6 






j* 




TOTAL 


1.217 x 10~ 5 






11 












t! 












11 












11 












ft 












11 












11 












11 












11 












11 












11 












11 












If 












11 












11 












11 












11 












II 












13 1 10 -s 









-94- 



The hazardous materials accident probability value for a segment times 
the associated consequences or population value (column 5) produces the risk 
value for transporting hazardous materials on that segment. Summing across 
all segments produces the total population risk for the entire route. The 
population risk for Alternative 1 when the hazardous materials class is flam- 
mable liquids is: 1.217 x 10" . For an individual living within the impact 
zone, the odds of being affected by a hazardous materials release are about 
one in one hundred thousand. 

Risk Comparison for Hazardous Materials Route Alternatives 

Worksheet 5 is used to summarize the population risk calculation and pro- 
perty inventories performed in the case study (see Table 24). Entries within 
the Land- Use columns may be either the risk values calculated for each land 
use type or simply summations of the amount of roadway frontage within each 
category. Similarly, entries within the Structures columns may be the risk 
value for bridges and overpasses along the route or the total number of these 
structures. In the Washington case study, the number of highway structures 
and amount of land-use frontage were recorded; property risk values were not 
calculated. 

The selection of the best route for a specified hazardous materials class 
will depend on the criteria the community applies in the evaluation process. 



Mathematically, this approach is not entirely correct, as the probability of a 
vehicle not reaching the next segment is overlooked (i.e. , having an accident). 
The true form of the equation is: 

P(Accident ) = P(Accident ) + [l-P(Accident )] P(Accident ) 

Total Route Segment 1 Segment 1 Segment 2 

+ [l-P(Accident )]P(Accident ) + . . . 

Segment 2 Segment 3 

However, the accident probabilities are so small that 1-P( Accident ) is 

Segment i 
effectively 1 and can be reasonably ignored. 

Land-use risks are calculated in the same way as the population risks ex- 
cept that the segment property value is substituted for the segment popula- 
tion value on Worksheet 4. Summing across all segments produces the 
property risk for the entire route. The methodology for this calculation 
was presented in Section 3. 



-95- 



1 



4 i 



-I 

is t, 
S £ 



is 

3» 


•> 














il 


4> a n, 

Sj ea § -4 -h 
•Hi • 2 M 


8tCi 2 <= « 

« u " O ID 
3 C S oi T> 

u ig : h -H 

CO rH ^ -H M 

• Oi •* 3 co 


•K 


■K 










2 

1 


CM 


in 


en 


en 








VI 

1*1 

I 

•a 


o> 


CN 


cm 


U1 
CM 








TO" 

c 

■H 
U 

S 


U-l > 


•A 

S 

m 


00 


ej> 


O 

CM 


o 

U-l 








oi 3 

(1) -3 
r-4 OJ 
•H 

E i- 

■K 
* 

a 

9 

a 

3 




CM 


U-l 


o 
in 


u-l 
m 








fc- 


m 


<• 


«3- 
-a- 


CM 
u-l 








z 

.V* 

OB 


| 


CM 


en 
u-l 


o 
en 


U1 








s 
a 


CM 


cm 


m 


CM 

ul 








i 


d 


o* 


m 

CM 


u-l 

CM 








a 

i 


3 

W 

S 


V) 

(— 1 




.c 
u 
en 

£N 
CM 


01 

fH 



JS 
u 
en 

m 
cm 


•K 


* 






- 


o 

a 

8 

3 


m 

09 

o* 

\0 


en 

CO 

o 

CO 


i 

O 
09 

-a- 


in 
u-i 
vO 








a 


r* m 
^ 1 
CM O 


X 

— m 
en o 


X 

— 1 Ul 

u-l 1 

vO O 


X 

en ui 
•J- 1 
00 o 








ii 


en 
en 

CM 


en 

CN 


en 

en 

CM 


o 

CM 
CM 








i 

5 


§ 


u-i 
o\ in ^i 

1 o> <u > 
i-i «» u in 
„ i as er\ 
■ M <■ 
J .2 ' 


u-i u-i 
cr> in cn 
en m ; cm 

1 ON 01 1 

h-l ^J- UH 

.. 1 aS 


u-i u-l 

en i en 

I u-i aj i 

hH OS 1-1 l-l 

a -a- as 

II „ fl 

iS l-l J -H 

^ > 


I en "umrs- 

m -a- uh^ 

I- 4 Tt 


u 

> 

1 3 


1 a 


1 a 


* 


*h 


cm 


en 


-T 









en 




■H 




u 




01 




u 




•H 




1-1 




u 


C 







01 


■H 


> 


i-l 


■H 


a 


u 


3 





iH 


a 


ra 


1-1 


> 


.12 


4) 


3 




01 


>> 




-a 


01 


3 



a <a 

a 1-4 
« u 

41 

O 4-1 



a 


OI 




ea 


■a 




01 


-T3 


u 


01 


ea 


01 


C 


3 


■H 




a 


u 


•H 





iH 


a 


0) 






71 


0) 


ea 


> 


3 


■H 




4-1 


a) 


01 


oi 


a 


3 


U 




01 


•n 


1-1 


c 


r^ 


ed 


< 


J 


■K 


* 



-96- 



The most obvious criterion is selection of that route which poses the lowest 
risk to population. In the case study, Alternative 1 had the smallest popula- 
tion risk value, followed in increasing order by Alternatives 2,3, and 4, re- 
spectively. 

Unless the differences between the risk values for the alternatives are 
fairly large, the methodology recommends that additional, subjective criteria 
be applied to aid the decision process. Table 25 presents the calculated risk 
values for the four alternatives and the percentage difference between them. 
Alternatives 1 and 2 cannot be strongly differentiated on the basis of a 6.4 
percent difference; however, Alternatives 3 and 4 are excluded from further 
consideration because their risk values exceed the lowest potential alternative 
by 34.0 and 49.6 percent, respectively. 

TABLE 25 

POPULATION RISKS ON THREE ALTERNATIVE HAZARDOUS 
MATERIALS ROUTES IN WASHINGTON, D.C. 



Alternative 


Population Risk 


Percent Difference 
From Alternative 1 


1 
2 
3 

4 


1.217 x 10~ 5 
1.311 x 10~ 5 
1.651 x 10~ 5 
1.843 x 10~ 5 


6.4 
34.0 
49.6 



Because Alternatives 1 and 2 are relatively similar with respect to popula- 
tion risk (and property risk values were not calculated for the alternatives) , 
subjective criteria were used to identify the different route characteristics 
that might make one alternative preferable to the other. The following dis- 
cussion documents the use of subjective criteria to select the hazardous mate- 
rials route for flammable liquids that poses the smallest overall threat to 
the community. 

Subjective Factors 

There are no clear-cut decision rules for the selection and application of 
subjective factors. In this third level of criteria (after evaluation of mandatory 
and variable factors), the community may wish to compare the remaining two 
alternatives along several dimensions. Worksheet 5 is structured to permit 
easy comparison of the alternatives. Table 24 presents the characteristics of 
the four alternatives for the Washington case study. 



-97- 



Neither Alternative 1 nor Alternative 2 is clearly preferable on the basis of 
overall length. The travel times in Alternative 2 will probably be longer than 
in Alternative 1, as the route includes segments on urban arterials. On the 
other hand, congested traffic conditions on the Beltway (1-495) frequently cause 
delays offsetting the potential travel time advantages for hazardous materials 
carriers routed on Alternative 1 . 



Another subjective criterion used in the case study was the property inven- 
tory. With fewer roadway structures along the route and only one sewage plant 
within the potential impact zone, Alternative 1 poses less threat to special 
properties than Alternative 2. 

Using the criterion of special populations. Alternative 1 is again preferable 
to Alternative 2. The measure of special populations for the case study was 
schools , and Alternative 1 had fewer schools in its impact zone than Alterna- 
tive 2. 

Conclusion 

Alternative 1 is the recommended hazardous materials route for vehicles 
carrying flammable liquids. Alternative 1 poses the lowest risk to residential 
population and exposes fewer roadway structures. Alternative 1 also has fewer 
schools within its impact zone than the next most likely alternative. In general, 
however, the differences between Alternatives 1 and 2 are not particularly large. 



SUMMARY 

Section 4 presents possible objective and subjective criteria that may be 
used in the final route selection. The study suggests that hazardous mate- 
rials routes be eliminated from consideration if a substantial margin of differ- 
ence can be observed in the risk values calculated for the alternatives. If a 
hazardous materials route selection cannot be made on the basis of the first 
two criteria levels (mandatory and variable) , various subjective criteria must 
be used to differentiate the alternatives. 

In the Washington, D.C. , case study, the alternative that used interstate 
highways exclusively and bypassed the major population centers proved to be 
the overall safest route. Of the initial four alternatives, Alternatives 3 and 
4 were eliminated because their population risks substantially exceeded those 
associated with Alternatives 1 and 2. Although the differences in the remain- 
ing two alternatives are not great, Alternative 1 may be designated as the 
preferred hazardous materials route on the basis of subjective criteria. 

The next section discusses the results of pilot testing the methodology 
in two additional jurisdictions. 

-98- 



REFERENCES 



1. National Safety Council, Accident Facts 1973-1978 , Chicago, Illinois. 

2. Price, Dennis L. , "Ten Most Critical Issues in Hazardous Materials 
Transportation," Report from A3C10 Committee, Transportation Re- 
search Board, National Research Council, 1979. 



-99- 



5. RESULTS OF PILOT TESTING CRITERIA FOR 
DESIGNATING HAZARDOUS MATERIALS TRANSPORT ROUTES 



PILOT TESTING OVERVIEW 

This section describes the results of pilot testing the hazardous materials 
route selection methodology presented in Sections 1 through 4 . The test ap- 
plications of the risk methodology were evaluated from two perspectives: if 
local agencies can understand and use it; and if it offers any advancement 
in the state-of-the-art in hazardous materials route selection. Results from 
two pilot tests are presented with respect to these criteria, and other perti- 
nent information is provided to enable potential users of this report to eval- 
uate staff and resource requirements for conducting local evaluations. 

Pilot tests were conducted in the cities of Nashville, Tennessee, and 
Seattle, Washington. The objectives of the performing agencies in these 
two communities differed somewhat, and this difference is reflected in the 
types of analyses performed and use of resources. In Nashville, a 14 mem- 
ber committee was assembled for this pilot test. It included representatives 
from the Department of Civil Defense, the Metropolitan Police and Fire De- 
partments, the Bellevue Volunteer Fire Department, the City Department 
of Traffic and Parking, the Metropolitan Planning Commission, the Fleet 
Transport Company (a common carrier), and Tennessee State University. 
This multidisciplinary group approached the pilot test with the objective of 
determining the preferred through routing for hazardous materials trans- 
port in Nashville. In addition to calculating the risk values, the Nashville 
committee spent considerable time evaluating subjective criteria factors to 
refine their analysis and choose the route that best satisfied a variety of 
criteria. 

The performing agency in Seattle, the Puget Sound Council of Governments 
(PSCOG) had several objectives when they performed the pilot test. One ob- 
jective was to develop data that would ultimately contribute to their compre- 
hensive hazardous materials management study that is underway. PSCOG 
wished to quantify some of the transportation and land use variables that might 
affect their hazardous materials policy recommendations and regarded the 
routing exercise as a useful way to become familiar with these variables and 
perform initial analyses of hazardous materials routing alternatives. Another 
objective was to provide inputs for the public discussion that is developing 
over hazardous materials management in the area. PSCOG wished to deter- 
mine if the routing methodology would be useful for public presentations and 
if they later became the basis for recommendations to the city councils with- 
in the Central Puget Sound Region. PSCOG also wished to determine the level 
of resources necessary to conduct routing analyses on a regional scale to eval- 
uate the cost-effectiveness of the methodology for possible future applications. 

-100- 



The results of the two pilot tests are presented below. Both perform- 
ing agencies demonstrated a strong level of interest and commitment to 
the project. Since the two pilot tests were approached differently, the 
findings provide a range of experience . The study team considers the two 
pilot tests representative of the types of uses to which the risk methodology 
materials would be applied and believes that the issues that arose during 
the demonstrations would likely be encountered in using the materials else- 
where. 



NASHVILLE PILOT TEST 

The City of Nashville pilot tested the risk methodology for about half of 
the major through routes in Metropolitan Nashville . The lead agendy for the 
pilot test was the Department of Civil Defense, which was assisted by repre- 
sentatives from the five public agencies, the common carrier, and the uni- 
versity listed above. Most members of the committee had not had an oppor- 
tunity to review the pre-draft final report for this project. A one-hour 35 mm 
slide briefing of the methodology and pre-draft materials was therefore pro- 
vided. 

Nashville's interest in acting as a test site stemmed from several local 
objectives, including the following: 

. The City had previously faced a hazardous materials routing 
problem (discussed below) and wanted to have the in-house 
capability to quantitatively evaluate alternate routes for future 
high risk materials transport through the City. 

. The City tentatively plans to conduct a comprehensive hazar- 
dous materials safety program and is currently planning to use 
the risk methodology to investigate the transportation aspects 
of the issue. 

. The City believes in contingency planning and views the metho- 
dology as a possible way to help identify the preferred existing 
and potential truckstops , storage facilities , and roadways for 
hazardous materials transport. 

One of the immediate uses of the pilot test was as a mechanism to organize, 
evaluate, and sensitize various City departments as regards hazardous mate- 
rials routing issues. Long-range plans for applying the pilot test results will 
be determined by City policies regarding hazardous materials management. 



-101- 




LEGEND: 

~ "~ mm ■■" Alttf iutiw 1 
— • — Atonwtm 2 
■*■ — — Atttnutivt 3 
^— Aliniutivt 4 



FIGURE 11: NASHVILLE; TENNESSEE, MAJOR ROUTES. 



-102- 



Pilot Test Objectives 

The hazardous materials risk methodology was applied to four alterna- 
tive through routes. The objective of this application was to determine, in 
general, which route(s) had the least risk. Figure 11 presents a sketch of 
the major routes in Nashville, the four alternatives studied, and the area's 
major geographic feature: the Cumberland River. 

Pilot Test Results 

Alternatives Selection 

Because the committee was fairly large, selecting the routes to be analyzed 
proved a challenging task which provided good insights into the real problems 
a community faces when applying the risk methodology. Representatives of 
virtually all potentially affected parties viewed the problem from their own 
perspectives, and this led to substantial discussion about which routes should 
initially be selected or eliminated. 

The motor carrier viewpoint was that the analysis should be limited to 
interstate routes because hazardous materials carriers mostly use inter- 
states, and that determining local routes is beyond the scope of the pilot 
test. 

The police department felt that examining the interstates was reason- 
able but that, because of the high accident rate along portions of 1-265, the 
Interloop of the city, 1-65 would be an obvious choice. The police depart- 
ment also felt the evaluation would not contribute much to their understand- 
ing of the problem . 

The Department of Civil Defense supported the police position and added 
that it had previously been asked to escort a shipment of phosgene gas 
through the City, arriving from 1-40 West going to 1-40 East, and had chosen 
a route that consisted of 1-40, 1-265, 1-24/65, 1-40/24, and 1-40. This 
route had been chosen because of the known high accident rate problem along 
the 1-65/40 link of the Interloop. Civil Defense also suggested that Briley 
Parkway might be an appropriate route since it has limited access and was 
built near interstate standards . 

The Traffic and Parking and Planning Commission thought population and 
traffic density would be less on Briley Parkway but also wanted to inves- 
tigate the 1-265 link of the Interloop. The committee decided to limit the 
pilot test to those hazardous materials entering the metropolitan area from 
the North on 1-65 and exiting by either 1-40 or 1-24. 



-103- 



Lastly, FHWA suggested that since this was a pilot test, State Route 
45 should be investigated because it was an alternative , although a some- 
what longer route. The length comparisons of the routes are indicated in 
Table 26. 

TABLE 26 
LENGTH COMPARISONS OF ALTERNATE 
HAZARDOUS MATERIALS ROUTES 



Route 



Alternate 1 (1-65 to 1-24) 
Alternate 2 (1-65, 1-265 to 1-24) 
Alternate 3 (Briley Parkway) 
Alternate 4 (State Route 45) 



Miles 



12.95 
14.00 
13.15 
21.30 



(Km) 



(20.72) 
(22.4) 
(21.04) 
(34.08) 



Level of Analysis Comparison 

After selecting the routes to be analyzed, the pilot test committee con- 
sidered the level of analysis for the test. The work plan was developed 
through an iterative process, whereby different approaches were proposed, 
discussed, rejected, or altered until agreement was reached on a final pro- 
cess. The following discussion briefly traces this process. 

The first proposed analysis plan (depicted in Figure 12) was an ambi- 
tious undertaking which sought to develop risk values for the alternative 
routes by time-of-day and for special versus commonly transported hazar- 
dous materials. (Special materials were defined as those hazardous materials 
classes in Table 17 (p. 71) that have a potential impact radius of greater than 
0.5 miles (0.8 km).) The proposed plan was subsequently revised to limit 
the analysis to special materials, in order to reflect resource availability. 



-104- 



^Peak 
Special Materials 




Analysis 

Plan \ Other 



Materials (deferred) \ Qff 



Peak 



Alternative 1 
Alternative 2 
Alternative 3 
Alternative 4 

Alternative 1 
Alternative 2 
Alternative 3 
Alternative 4 



FIGURE 12: ANALYSIS PLAN 1 

The product of this analysis would have been very useful to the Depart- 
ment of Civil Defense if they were again asked to determine a route and pro- 
vide an escort for a special hazardous materials shipment. The committee, 
however, chose to reject the proposed plan for two reasons. First, the Traf- 
fic and Parking Commission pointed out that signing separate hazardous mate- 
rials routes for peak and off-peak would be difficult at best. Second the 
police department indicated that enforcement would be a considerable prob- 
lem. Analysis Plan 1 was thus rejected primarily for practical reasons; 
it would have hindered effective implementation and enforcement of the analy- 
ses results. 

Analysis Plan 2, was essentially a refinement of Analysis Plan 1 in that 
based on the reasons just presented, the committee thought the peak and off- 
peak analysis should be tabled for later refinement. 

The next issue was to select the hazardous materials class to be analyzed. 
Further consideration of special materials routing was eliminated at this point, 
as the committee lacked information indicating what special materials were 
carried in the area. After one of the committee members argued that the 
time being spent on this phase of the project was becoming excessive, the 
committee chose to analyze the routes based on the impact distance that best 
represented most hazardous materials. In summary, the committee chose 
to analyze four alternative through routes for the transportation of hazardous 
materials with a potential impact radius of 0.5 miles (0.8 km). In effect, the 
committee accepted the MTB accident date as default information for which 
materials are transported in the area. The final analysis plan (see Figure 
13) was adopted for evaluating shipments of flammable liquids, combustible 
liquids, and corrosives. 



-105- 



Special 



(deferred) 



Analysis 



Plan 




Materials 



Other 



Alternate 1 
Alternate 2 



Materials 



Alternate 3 
Alternate 4 



Peak and 
off-peak 
comparison 
to be done 
later 



FIGURE 13: FINAL ANALYSIS PLAN 



A Priori Route Selection 

Before initiating the route analyses, the contractor asked all members 
of the committee to cast a ballot for their intuitively preferred routing alter- 
native. The purpose of this exercise was to help determine whether the risk 
methodology advances the state-of-the-art in hazardous materials route desig- 
nation. Table 27 shows the results, which indicate a preference for Alternative 
3. (The a priori judgments are compared to the calculated risk values later 
in the text.) 

TABLE 27 

INTUITIVELY PREFERRED ROUTINGS 



Alternative 



Number of Votes 



1 
2 
3 
4 



Route Segmentation and Data Collection 

The next step of the analysis consisted of segmenting the alternatives and 
collecting data pertinent to the analysis. Accident records, traffic maps, and 
land-use maps were obtained from the Metropolitan Police Department, Traf- 
fic and Parking Department, and Metropolitan Planning Commission. 

An inspection of the available data suggested that route segmentation could 
best be done on the basis of average annual daily traffic (ADT). ADT was 
used to segment the routes because the accident and population data were for- 
matted in a way that could be easily aggregated into segments corresponding 
to ADT segments . 



-106- 



rf 




LEGEND: 

■ Alternative 1 
-— • —Alternative 2 
— — — Alternative 3 
— -— — Alternative 4 



FIGURE 14: ROUTE SEGMENTATION AND ADTs(OOO) 



-107- 



Figure 14 illustrates the results of the route segmentation and the ADTs 
used for the analysis. Only one ADT value was used for Briley Parkway 
(and, similarly, State Route 45) because the variation in ADTs along these 
routes did not exceed 10 percent. 

Probability Calculations 

Accident rates for the probability calculations were developed from the 
Metropolitan Police Department computerized accident data base. After a 
printout was obtained of all accidents that occurred during the year on a 
particular route, the accident frequencies were manually sorted and assigned 
to the proper route segments. The sorting required a high degree of famili- 
arity with the roadways, as the accidents were recorded by intersection. 
Fortunately, the police department representatives were able to determine 
easily the number of annual accidents on each alternative's segments. 

After determining accident frequencies on each segment, the committee 
calculated the accident rates by using the following formula: 



Accidents 



Million Vehicle- Miles = Accidents/Year 6 

365 Days/Year x ADT x Segment Length x 



Accident probabilities were calculated subsequently by multiplying the accident 
rate on a segment by its length. The probability values are presented in Fig- 
ure 15. 

Consequence Calculations 

The Nashville Metropolitan Planning Commission maintains an up-to-date 
census data base aggregated by planning zones. Although the boundaries of 
the planning zones are not based on census tracts, the format is similar and 
the information just as easy to use. 

The committee was not satisfied with census population alone, however, as 
the consequences indicator and chose to introduce another variable. This dis- 
satisfaction was due to the fact that in many cases motorist population (as 
measured by ADT) was equal to or greater than the population within a half 
mile (0.8 km) of either side of the roadway. Accordingly, exposed population 
in each segment was calculated by adding census population to the product of 
one-half the ADT times the average auto occupancy (1.35 motorists per vehi- 
cle). One-half the ADT was used because a great many of the trips were 
assumed to be work trips, and the motorist could not be in two places simul- 
taneously (i.e. , both morning and evening peak). The resulting population 
exposure values are indicated in Figure 16. 



-108- 



rf 




LEGEND: 

^""■""•Allwiudvt 1 

— • • — Altenotivt 2 

— — — Alttrmtive 3 

Ah wimiw 4 



Pfoec/r) Probability of Any Vthtefe Acchtait 

FIGURE 15: ACCIDENT PROBABILITIES ON ROUTE SEGMENTS (xlO* 6 ) 



-109- 



rf 




LEGEND: 

■ Alternative 1 
— • —Alternative 2 
— — — Alternative 3 
—-—Alternative 4 



FIGURE 16: POPULATION EXPOSURE BY SEGMENT 



-110- 



Risk Calculations 

To calculate hazardous materials risks on each route, the accident prob- 
abilities reported in Figure 15 were factored to represent the incidence of 
hazardous materials accidents in the total accident record. The probability 
of a hazarous materials accident on each segment was the multiplied by the 
respective population to produce segment risk values. The segments on each 
alternative were then added, to produce the total route risk values indicated 
in Table 28. 

TABLE 28 
SUMMARY OF RISK VALUES 



Alternative 



Risk Value (10 " 6 ) 



57.15 
70.83 
51.40 
18.05 



This finding was somewhat surprising, as the committee members had pre- 
viously voted intuitively for the routes shown in Table 26. 

Although nobody had cast a ballot for Alternative 4, it had the lowest 
calculated risk value. After further discussion, it was learned that most 
members felt that motor carriers would not use it because of bridge limi- 
tations, at-grade rail-highway crossings, and several sharp turns. Through 
its knowledge of local conditions, the committee was effectively applying the 
first mandatory criterion of Section 4. In retrospect, if the briefing had 
stressed the mandatory criteria more, the committee would have eliminated 
Alternative 4 earlier because of physical constraints. 

The Committee members who had voted for Alternative 1 took the posi- 
tion that they would still favor Alternative 1 over Alternative 3 most of the 
time because the analysis failed to consider an important special popula- 
tion along Alternative 3: Opryland USA, which has an average tourist popu- 
lation of 20,000 persons 3 months of the year (see Figure 17). If Opryland's 
population is included in the analysis, then the risk value for Alternative 3 
increases to 72 x 10 , which makes Alternative 1 a clearly less risky route. 

To provide additional support for this decision, the fire and ambulance 
locations were plotted along the Alternatives as indicated in Figure 17. This 
subjective criterion suggests that Alternative 4 would have much less sup- 
port in the immediate area in the event of a hazardous materials release. 



-Ill- 




LEGEND: 

Alternitive 1 
— • — Atomitta 2 
•— — — Alternative 3 

AIHtmtweA 



FIGURE 17: LOCATION OF FIRE (F) AND AMBULANCE (A) STATIONS; 

AND OPRYLAND, USA 



-112- 



Nashville Committee Reaction to the Methodology 

The Nashville participants performed the analysis well and quickly 
grasped the methodology. The reaction to the methodology was highly favor- 
able, and there was considerable discussion about extending, refining and pos- 
sibly computerizing it for use at the citywide level. The participants also 
demonstrated sensitivity to the political implications of their findings by noting 
that if Alternative 3 were a designated hazardous materials route, then sev- 
eral truck stops might suffer from a loss of business . However, it was gen- 
erally felt that this type of problem could be resolved. 

From FHWA's evaluation perspective, few problems were encountered. 
Assistance was limited to helping some participants understand the metho- 
dology; this was accomplished with a training/implementation document or 
a seminar. Participants were not always aware of each other's responsi- 
bilities in the hazardous materials management field, and the formation of 
the committee greatly helped an exchange of information within the Nashville 
metropolitan area. Within their respective fields of specialization, however, 
the participants clearly had an excellent knowledge of the roadway, accidents, 
population, and hazardous materials carrier operations in the region. 

Few questions were raised during the pilot test. Inquiries were made 
about FHWA's intent regarding this report and the project and about scien- 
tific notation (10~ ), and questions were asked pertaining to procedures in 
Sections 1 through 4 of the pre-draft report which had not yet been read. 
In general, the participants felt comfortable with and pleased by the appli- 
cations of the methodology to their area. 

Level-of-Effort 



The Nashville pilot test required approximately 70 person-hours to eval- 
uate about 50 .miles (8 km) of roadway. Three and one-half person-hours 
were expended in the initial meetings where the routing issues were identified 
and the alternatives to be evaluated selected. 

Data collection required 6 person-hours. This relatively rapid effort was 
possible because the committee consisted of representatives from various 
agencies who were able to identify quickly and gather the necessary informa- 
tion. Route segmentation was accomplished in 4 person-hours, and the acci- 
dent probability calculations required approximately 6 person-hours. Develop- 
ing consequence values for resident populations entailed 8 person-hours of ef- 
fort, and adding the ADT factor required 1 additional person-hour. Calculat- 
ing and discussing the risk values involved 10 person-hours. Much like the 
early part of the analysis, convening the committee to discuss the findings 
involved substantial investments of time. 



-113- 



Educational background of the participants included high school, special 
training, college, and several advanced degrees. The participants were well- 
versed in their respective fields and interacted at a high professional level. 
The contractor's presence at the site was not essential. The committee de- 
monstrated a good understanding of the methodology and performed the neces- 
sary calculations with ease. The contractor's principal contribution was to 
facilitate the process, which suggests that the person-hours cited above may 
be conservative . The same results would have undoubtedly occurred with- 
out the contractor, but it might have taken somewhat longer. The contrac- 
tor's level of effort was an additional 10 hours. 

Anticipated Use of the Risk Analysis 

At least two of the agencies indicated an interest in pursuing the metho- 
dology as a means to improve their services to the city. The agencies anti- 
cipate using the methodology in slightly different ways: one for project review, 
and the other for hazardous materials routing. The two agencies anticipate 
that results of their analyses will be considered at the highest appropriate 
local government level (e.g., Police for enforcement, Traffic and Parking 
for roadways, etc.). This expression of interest was interpreted as a strong 
positive endorsement of the methodology and a measure of the participants' 
confidence in the findings. 



PUGET SOUND PILOT TEST 

The Puget Sound Council of Governments (PSCOG) was the performing 
agency that applied the risk methodology to several highways in the Seattle 
metropolitan area. PSCOG is currently conducting a comprehensive multi- 
modal study of hazardous materials transportation in the four-county Cen- 
tral Puget Sound Region with funding provided by the U.S. Department of 
Transportation. Although PSCOG is responsible for studying the entire 
region, the pilot test application was limited to the Seattle area because 
of resource constraints. 

The Comprehensive PSCOG Hazardous Materials Study has four essen- 
tial objectives: 

. to identify the types and amounts of hazardous cargo trans- 
ported through the region by ship, rail, motor carrier, air, 
and pipeline; 

. to evaluate the roles, responsibilities, and capabilities of 
agencies with hazardous materials prevention or response 
mandates; 



-114- 



. to survey federal and state programs elsewhere to determine 
their applicability to the Central Puget Sound Region; and 

. to develop options for a regional prevention and response plan 
based on the preceding analyses and incorportating public re- 
sponsibilities, industry perspectives , legal considerations, 
resources requirements , etc . 

The results of the comprehensive study will be presented to public and pri- 
vate sector officials in the region, in order to assess the need for hazard- 
ous materials transportation management and evaluate possible prevention 
and response options. 

Pilot Test Objectives 

The risk methodology was applied to six alternative routes. The objec- 
tive of these applications was to calculate risk values for alternative through 
routes in the Seattle area and alternative local routings for traffic approach- 
ing a major industrial area from both north and south. The Seattle pilot 
test basically demonstrated that a relatively small amount of resources can 
be used effectively to determine the relative risks of routes through and into 
a city. 

The principal focus of the pilot test from the contractor's perspective was 
to see if the performing agency could readily understand and use the materials 
presented in Sections 2, 3 and 4. PSCOG's motive for performing the analy- 
sis was to determine the suitability of the risk analysis technique for use in 
their comprehensive hazardous materials management study. PSCOG also 
wanted to become familiar with the types and availability of data that are 
appropriate for analyzing public safety, and to develop a series of initial risk 
calculations that can be refined at a later date when resources permit. At 
the time of the pilot test, PSCOG was only in its second month of the 15 -month 
hazardous materials study and was in the process of assembling a steering 
committee for the project. It was unclear at that time whether or not rout- 
ing was going to be included in the project scope, but PSCOG felt the ancil- 
lary benefits of becoming more familiar with this aspect of hazardous mate- 
rials issues warranted its involvement. 

Pilot Test Results 

Alternative Selection 

As can be seen in Figure 18, the City of Seattle is bounded on the east 
and west by water, and a major industrial area is located south of the cen- 
tral business district on Elliot Bay. The 6 alternative routings identified in 



-115- 



Puget 
Sound 




Renton 



FIGURE 18: SEATTLE METROPOLITAN AREA 



-116- 




LEGEND: 

-t Alternative 1 

Alternative 2f 

O — Alternative3 

x Alternative 4 

Alternative 5 

• — Alternative 6 



FIGURE 19: ALTERNATIVE HAZARDOUS MATERIALS ROUTINGS 



-117- 



Figure 19 were selected because they constitute the major roadways in the 
area and provide access to one of the largest industrial complexes in the 
region. The routings are principally on interstates or limited access state 
highways. Two of the local routings (Alternatives 3 and 4) include urban 
arterials on some segments but, in general, have good design characteris- 
tics. PSCOG felt that all of the alternatives were viable routing options 
and were commonly used by carriers. 

The alternative through routes, 1-5 and 1-405, provide a good example 
of the tradeoffs associated with transporting hazardous materials through 
versus around a city. The route that bypasses the City ^1-405) is longer 
(30.3 miles (48.5 km) versus 28.2 miles (45.1 km) on 1-5) but travels 
through less densely populated areas. The local routes, on the other hand, 
travel along very similar corridors but are principally differentiated by 
their roadway characteristics. 

A Priori Route Selection 

Before calculation of the risk values, the two members of PSCOG involved 
in the pilot test were asked to select the roadways that would be their pre- 
ferred hazardous materials routes based on their knowledge of the area. The 
two respondents had conflicting views based on their own sense of which areas 
had higher population densities, better roadway characteristics, greater peak 
and off-peak travel, etc. This lack of agreement indicated early on that the 
results were not necessarily a foregone conclusion and that the subjective 
criteria individuals are likely to apply to the process will vary significantly. 

Probability Calculations 

In order to calculate the probabilities (and consequences) for each route, 
it was necessary to segment the alternatives into discrete sections. The 
routes were segmented on the basis of accident rates and the boundaries of 
the PSCOG planning districts (which were either Census tract boundaries or 
combinations of Census tracts). 

State and City accident rate data were available for all of the routes eval- 
uated. The performing agency felt that these observed values would be more 
accurate than values predicted by the accident rate models, as well as more 
cost-effective. On some segments of roadways within the City, it was neces- 
sary to calculate the accident rates using observed accident frequencies and 
average annual daily traffic counts (ADT). The following formula was used 
to calculate the accident rates on these segments: 

Accident = Number of Accidents per Year 6 

Million Vehicle- Miles 365 days /year x ADT x Segment Length x 10 



-118- 




PUGET 
SOUND 



LEGEND 



I Alttmitivt 1 
MHI Alumativ* 2 

P(icdw) - Probability of Any Vohiclo 
Accident 



FIGURE 20: ACCIDENT PROBABILITIES ON ALTERNATIVE THROUGH 
ROUTE SEGMENTS (xlO" 4 ) 



-119- 



Puget 
Sound 



1-5 & M05 
P(acc/v) ■ 14.36 4 




—■"O"*" Alternative 3 
■"•'■■ Alternative 6 
P(aee/v) « Probability of Any Vehicle 
Accident 



P(acc/v) «4.370 



FIGURE 21: ACCIDENT PROBABILITIES ON ALTERNATIVE LOCAL ROUTES (x 10 -«) 



-120- 



Puget 
Sound 




P(acc/v) - 4.370 



LEGEND: 

— X —■ Alternative 4 
__.•■•_ Alternative 5 



P(HM ACC) - Probability of a Hazardous 
Material! Accident 



FIGURE 12: ACCIDENT PROBABILITIES ON ALTERNATIVE 
LOCAL ROUTE SEGMENTS (xlO 6 ) 



-121- 



The probability values for all vehicle accidents on the through and local routes 
are presented in Figures 20, 21, and 22. 

Consequence Calculations 

PSCOG maintains an EMPIRIC forecasting model and uses it to update its 
employment and population estimates for the region. The risk analysis was 
conducted with 1980 estimates for these parameters, to capture the most re- 
cent distribution of land use. In the course of developing the model, PSCOG 
created its own districts which were essentially based on Census boundaries. 
This did not create any problems for the pilot test since the information is the 
same as that provided in the Census, but it is formatted on a different geogra- 
phic basis. The performing agency chose to refine the consequences-estimat- 
ing component of the risk methodology by introducing employment as a vari- 
able. The objective was to portray more accurately the time-of-day locations 
of persons along the alternative hazardous materials routes. The pilot test 
was first conducted using population along the route and later with a combined 
population and employment value as the consequence variable to test the sen- 
sitivity of the risk analysis findings . 

The resident populations identified in Figures 23, 24, and 25 consist of 
persons living within a half-mile on either side of the roadway. PSCOG 
chose the half-mile impact zone because it wanted to estimate the risk as- 
sociated with transporting flammable liquids. Gasoline and petroleum pro- 
ducts are commonly carried in the Puget Sound Region because of refining 
operations in the area and distribution activities at the port. 

Figures 23, 24, and 25 also show the combined values for residential 
population and employment within the impact zones. The employment vari- 
able measures the number of persons working within that zone. Although this 
has the effect of counting employed persons twice (once at their home and 
again at their job) , PSCOG felt it was important to portray more accurately 
the daytime distribution of persons . Ideally, it would be desirable to factor 
down the resident populations to represent the migration of persons from 
home to work place, but PSCOG did not feel the added refinements justified 
the effort at that time. Another confounding influence was persons who live 
and work in the same zone. Recognizing these biases, PSCOG chose to in- 
clude employment in order to see how sensitive the risk calculations would 
be to this addition. 

Risk Calculations 

The relative risk differential for the through routes (Alternatives 1 and 2) 
remained about 2:1, with and without the addition of employment to resident 
population (see Tables 29 and 30). Similarly, Alternatives 3 and 6 preserved 

-122- 




LEGEND: 

' j-|— f- Alternative 1 
ifia Alternative 2 
POP R "Resid«ntial Population 

POP R+E "Re«idential Population 
and Employment 



FIGURE 23: POTENTIAL CONSEQUENCES ON ALTERNATIVE THROUGH ROUTES 



-123- 




POP R =491 
POP R4E =3683 



■■oaaio Alternatives 
«•«»• Alternatives 



POP R - Residential Population 
P0P R&E ~ Residential Population and Employment 



nGURE 24 : POTENTIAL CONSEQUENCES ON ALTERNATIVE LOCAL ROUTES 
ALTERNATIVES 3 AND 6 



-124- 



Puget 
Sound 



Spokane St 
POPr - 2915 
POPr+E - 20018 




POPr - 342 
POP R+ ^-3683 



LEGEND: 



_y — Alternative 4 
■■■mi Alternative 5 

POPr - Residential Population 

POPr+e - Residential Population + Employment 



FIGURE 25: POTENTIAL CONSEQUENCES ON ALTERNATIVE 
LOCAL ROUTES 
ALTERNATIVES 4 AND 5 



-125- 



the same relative risk relationships when employment was added. Alter- 
natives 4 and 5, however, reversed their relative risks when employment 
was introduced. This is because of the heavily industrialized nature of the 
area through which Alternative 4 passes, and the roughly fivefold increase 
in risk when employment is added compared with the less than threefold 
increase on Alternative 5 under similar circumstances. Tables 28 and 29 
summarize the risk values for population only and for population plus em- 
ployment, respectively. 

r-'f 

The through routing differentials are great enough to make 1-405 (Alter- 
native 1) the preferred route on the basis of the risk calculations alone. The 
local routings were not definitive, however, and the calculated risk values 
for Alternatives 3 and 6 were extremely close. Alternatives 4 and 5 exhibited 
a major risk difference when employment was considered but showed the op- 
posite relationship when the calculations were based on population alone. 

PSCOG Reaction to the Methodology 

The application of the risk methodology was well received by PSCOG. 
The calculated risk values generally confirmed the prior routing judgments 
of persons knowledgeable about the area, although additional subjective cri- 
teria made one local routing appear less attractive than the relative risk 
values implied; a difficult turn and extremely busy intersection on Alterna- 
tive 5 led one of the participants to conclude that this route was less pre- 
ferable to Alternative 4, even though the population-plus -employment risk 
value was higher. 

Lack of pilot test time prevented the performing agency from applying 
additional subjective criteria to the routing alternatives. The participants 
identified other subjective criteria which may be applied at a later date, 
including emergency response capability and time-of-day traffic patterns. 

As discussed above, PSCOG changed the consequence methodology to in- 
clude employment land-use patterns as well as residential activities. The 
risk methodology proved flexible enough to incorporate this change without 
major modifications in the structure of the analysis or the underlying assump- 
tions. Other modifications discussed included stratifying the accident rates 
by daytime and nighttime, and calculating the risk values on the hypothesized 
daytime populations versus the nighttime populations. The methodology is 
well-suited to incorporate this change too, but the resource requirements 
may preclude the use of this modified technique on all but a few routes. 



-126- 



TABLE 29 
ALTERNATIVES COMPARISON FOR RESIDENTIAL POPULATION 



Alternative 


Length (miles) 


Risk (x 10" 6 ) 


Total Exposed 


1 


30.3 


6.06 


54,873 


vs. 








2 


28.2 


29.71 


119,924 


3 


20.5 


24.77 


98,144 


vs. 








6 


20.7 


25.52 


105.,959 


4 


8.7 


1.67 


9,207 


vs. 








5 


7.8 


2.20 


13,680 



TABLE 30 

ALTERNATIVES COMPARISON FOR RESIDENTIAL 

POPULATION AND EMPLOYMENT 



Alternative 


Length (miles) 


Risk (x 10" 6 ) 


Total Exposed 


1 


30.3 


11.70 


96,068 


vs. 








2 


28.2 


68.68 


276,844 


3 


20.5 


50.57 


193,695 


vs. 








6 


20.7 


53.67 


244,025 


4 


8.7 


10.01 


37,183 


vs. 








5 


7.8 


6.07 


36,430 



-127- 



Level-of-Effort 

The pilot test required about 42 person-hours to evaluate 120 miles of 
roadway (of which 30 miles overlapped). The major time requirement was for 
data collection (requiring 16 person-hours), followed by the consequence mea- 
surements (10 person-hours) and segmenting the routes (6 person-hours). The 
other activities required the following levels of effort: 

. stating objectives and identifying alternatives (3 person-hours); 

. developing work plan (2 person-hours); 

. calculating accident probabilities ( 3 person-hours); and 

. calculating risk and discussing findings (2 person-hours). 

Because of resource constraints, the participants chose to defer a de- 
tailed analysis of the results until a future date. The risk analysis only 
briefly used subjective criteria, and property was not used as a consequence 
measure. Additional time requirements to incorporate these activities into 
the evaluation would probably require 20 to 40 person-hours. 

The contractor's presence at the test site was helpful but not essential. 
Assistance was limited largely to an initial structuring of the problem and 
some fairly minor suggestions on how to calculate accident probabilities and 
develop consequence values. The staff member performing the bulk of the 
analysis felt that there was little or no need for outside help and that the 
methodology was clearly stated and readily understandable . This individual 
received his Master's Degree in Political Science and had previous experi- 
ence with the concept of risk analysis . Although he had no previous know- 
ledge of traffic engineering, he clearly understood those parts of the metho- 
dology relative to accident rates and their calculations. In addition, the 
analyst had acquired a helpful publication from the Washington State Highway 
Department which provided formulas for calculating accident rates. 

Anticipated Use of Risk Analysis 

It was not clear at the conclusion of the pilot test how PSCOG would in- 
tegrate the findings from the risk analysis into its overall hazardous mate- 
rials study mandate. The agency did feel that the risk methodology provided 
good insights into issues to be considered when routing hazardous materials 
and that it was well suited to public presentation because it was easy to under- 
stand. PSCOG does not have the authority to implement any policies but can 
only make recommendations to the appropriate City, County, and State of- 
ficials. The agency indicated a desire to conduct additional risk analyses 
throughout the four-county region and was sensitive to the political, social, 
and economic implications of any routing recommendations . 

-128- 



SUMMARY 

This section presented the results of pilot testing the hazardous materials 
route selection methodology in Nashville and Seattle . The methodology was 
well received, and its products were acceptable to the performing agencies. 

Based on the pilot test results, the study concludes that the risk metho- 
dology presented in Sections 1 through 4 has merit and appears to fill an 
information need that many cities may nave. From the contractor's experi- 
ences in Nashville and Seattle, the study also concludes that a user-oriented 
guide is warranted to provide a simplified presentation of the methodology. 
An abbreviated user's guide would likely enjoy better distribution than the 
final report and would be of service to many communities concerned with 
hazardous materials transportation. 



-129- 



APPENDIX A 

DEFINITIONS OF CLASSES OF HAZARDOUS MATERIALS 
This appendix has been abstracted from a U.S. DOT publication entitled 

"Hazardous Materials Definitions." It was published in January 1979 and is 
available from the Materials Transportation Bureau. 

EXPLOSIVES 



An Explosive - Any chemical compound, mixture, or device, the 
primary or common purpose of which is to function by explosion, 
i.e., with substantially instantaneous release of gas and heat, 
unless such compound, mixture, or device is otherwise specifi- 
cally classified in Parts 170-189. (Sec. 173.50)* 



CLASS A Detonating or otherwise of maximum hazard. The nine types of 
EXPLOSIVE Class A explosives are defined in Sec. 173.53. 



CLASS B In general, function by rapid combustion rather than detonation 
EXPLOSIVE and include some explosive devices such as special fireworks, 
flash powders, etc. Flammable hazard . (Sec. 173.88) 

CLASS C Certain types of manufactured articles containing Class A or Class 
EXPLOSIVE B explosives, or both, as components but in restricted quantities, 
and certain types of fireworks. Minimum hazard . (Sec. 173.100) 

BLASTING A material designed for blasting which has been tested in accord- 
AGENTS ance with Sec. 173.114a(b) and found to be so Insensitive that 
there is very little probability of accidental initiation to 
explosion or of transition from deflagration to detonation. 
(Sec. 173.114a(a)) 






FLAMMABLE, COMBUSTIBLE, AND PYROPHORIC LIQUIDS 



FLAMMABLE 
LIQUID 



COMBUSTIBLE 



LIQUID 



Any liquid having a flash point below 100 F. as determined by 
tests listed in Sec. 173.115(d). Exceptions are listed in 
Sec. 173. 115 (a). 

Any liquid having a flash point above 100 F. and below 200 F. as 
determined by tests listed in Sec. 173.115(d). Exceptions to this 
are found in Sec. 173.115(b). 

Pyrophoric Liquid- Any liquid that ignites spontaneously in dry or 
moist air at or below 130 F. (Sec. 173.115(c)) 



*Refers to a section in the Code of Federal Regulations. 



-130- 



COMPRESSED GASES 



FLAMMABLE 
GAS 



Compressed Gas - Any material or mixture having in the container 
a pressure exeeding 40 psia at 70 F. , or a pressure exceeding 
104 psia at 130°F. J or any liquid flammable material having a 
vapor pressure exceeding 40 psia at 100°F. (Sec. 173.300(a)) 

Any compressed gas meeting the requirements for lower flammability 
limit, flammability limit range, flame projection, or flame prop- 
agation criteria as specified in Sec. 173.300(b). 



NONFLAMMABLE Any compressed gas other than a flammable compressed gas. 
GAS 



FLAMMABLE SOLIDS, OXIDIZERS AND ORGANIC PEROXIDES 



FLAMMABLE Any solid material, other than an explosive, which is liable to 
SOLID cause fires through friction, retained heat from manufacturing 
or processing, or which can be ignited readily and when ignited 
burns so vigorously and persistently as to create a serious trans- 
portation hazard, (sec. 173.150) 

OXIDIZER A substance such as chlorate, permanganate, inorganic peroxide, 
or a nitrate, that yields oxygen readily to stimulate the com-' 
bustion of organic matter. (See Sec. 173.151) 



ORGANIC An organic compound containing the bivalent -0-0 structure and 
PEROXIDE which may be considered a derivative of hydrogen peroxide where 
one or more of the hydrogen atoms have been replaced by organic 
radicals must be classed as an organic peroxide unless — (See 
Sec. 173.151(a) for details) 



CORROSIVE MATERIALS 

CORROSIVE Any liquid or solid that causes visible destruction of human skin 
MATERIAL tissue or a liquid that has a severe corrosion rate on steel. (See 
Sec. 173.240(a) and (b) for details) 



-131- 



POISONOUS MATERIALS, ETIOLOGIC AGENTS, AND RADIOACTIVE MATERIALS 



POISON A Extremely Dangerous Poisons - Poisonous gases or liquids of such 
nature that a very small amount of the gas, or vapor of the 
liquid, mixed with air is dangerous to life . (Sec. 173.326) 






POISON B Less Dangerous Poisons - Substances, liquids, or solids (including 
pastes and semi-solids) , other than Class A or irritating materials, 
which are known to be so toxic to man as to afford a hazard to 
health during transportation; or which, in the absence of adequate 
data on human toxicity, are presumed to be toxic to man . 
(Sec. 173.343) 

IRRITATING A liquid or solid substance which upon contact with fire or when 
MATERIAL exposed to air gives off dangerous or intensely irritating fumes, 
but not including any poisonous material, Class A . (Sec. 173.381) 



ETIOLOGIC 
AGENT 



An "etiologic agent" means a viable micro-organism, or its toxin 
which causes or may cause human disease. (Sec. 173.386) (Refer 
to the Department of Health, Education and Welfare Regulations, 
Title 42, CFR, Sec. 72.25(c) for details.) 



RADIOACTIVE 
MATERIAL 



Any material, or combination of materials, that spontaneously 
emits ionizing radiation, and having a specific activity greater 
than 0.002 microcuries per gram. (Sec. 173.389) NOTE ; See Sec. 
173.389(a) through (1) for details. 



ORM-A, B or C (Other Regulated Materials) - Any material that does 
not meet the definition of a hazardous material, other than a 
Combustible liquid in packagings having a capacity of 110 gallons 
or less, and is specified in Sec. 172.101 as an ORM material or 
that possesses one or more of the characteristics described in 
ORM-A through D below, (sec. 173.500) 

NOTE : An ORM with a flash point of 100 F. to 200 F., when trans- 
ported with more than 110 gallons in one container shall be 
classed as a combustible liquid . 



-132- 



OTHER REGULATED MATERIALS 



ORM-A A material which has an anesthetic, irritating, noxious, toxic, or 
other similar property and which can cause extreme annoyance or 
discomfort to passengers and crew in the event of leakage during 
transportation. (Sec. 173.500(a)(1)) 

ORM-B A material (including a solid when wet with water) capable of 

causing significant damage to a transport vehicle or vessel from 
leakage during transportation. Materials meeting one or both of 
the following criteria are ORM-B materials: (i) A liquid substance 
that has a corrosion rate exceeding 0.250 inch per year (IPY) on 
aluminum (nonclad 7075-T6) at a test temperature of 130 F. An 
acceptable test is described in NACE Standard TM-01-69, and (ii) . 
Specifically designated by name in Sec. 172.101. (Sec. 173.500 
(a)(2)) 

ORM-C A material which has other inherent characteristics not described 
as an ORM-A or ORM-B but which make it unsuitable for shipment, 
unless properly identified and prepared for transportation. Each 
ORM-C material is specifically named in Sec. 172.101. (Sec. 
173.500(a)(4)) 



A material such as a consumer commodity which, though otherwise 
subject to the regulations of this subchapter, presents a limited 
hazard during transportation due to its form, quantity, and packaging. 
They must be materials for which exceptions are provided in 
Sec. 172.101. A shipping description applicable to each ORM-D 
material or category of ORM-D materials is found in Sec. 172.101. 
(Sec. 173.500(a)(4)) 



-133- 



APPENDIX B 



MATERIALS TRANSPORTATION BOARD 
HAZARDOUS MATERIALS INCIDENTS REPORTS 
BETWEEN JULY 1973 AND DECEMBER 1978 
(PLUS SELECTED BUREAU OF MOTOR CARRIER 
SAFETY REPORTS NOT INCLUDED IN THE MTB DATA) 



Note : Reports identified with a dot in the left-hand margin report the same 
accident more than once, and the duplicates were eliminated when the 
hazardous materials accident frequency distributions were developed 
for Table 12 on page 59. 



-134- 



iiiii.iiii:iiiiillliiiiiiiiiiiiiiziiiiii:iiiiiiii3 
i i I i i. I i i i i i I i i t i i i i i i ; i i i i i i i i i i i i (( i i i i i i i I i i i i 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX3 



XXX 

.III 
xxxxxxxxxxx 



inin«!n^inintninintninininintnininwinintninininininin^inin«inininininininui^uTininininw^ 



oooooooooooooooooooocMooooooooooooisoNorJoor^orsoor^otNOO 

CN *-i CM CN »* »4 4-4 CM 



NNrifjr>PJfslMNWMNNNri(NNrjNNNNN(NN^NP^NN^NWf4MCVINWNNNrilNNtv.NNr>INCN 

M N N N x N MN N N N M M N N N M N IN H CN CN CN CN -* (N •* CN «H CN CN CM CN CN Nh (M CN CN 



z 

UJ 

a 

(-4 
O 
U 

<t 

« 
-J 
3 
U 

1-4 

X 
UJ 

r> 



z 
o 
o 

en 
ui 
o 

<r 

£ 

a 

0) 

UJ 



-J _J _l _! _l _J _J _l CO _| _j _| _| _l _1 _i _i _J _l — t I I t _J _l 

<E<r«<r<r<x«<tiii<E<r<i<x<t'«<i<t«-'X <i <z c « <r c 
ooooouoojoouoiiooooo oaooo a 



_i _i _i i i i i 

<r <t <t <t c « <r 

CO Q O C9 CD C9 O 



_J _l -J -I 

<z <z <z <e 

oooo 



(J W*— ''— '■— * W W <— *l^<_ J ^_J >«l . P (_/ <_J W <~ ■ WW W W W W W W WW W W 

oocNif)'HOOcoooo , oooi^ooooomcD«rooooooooooofsoomooooo>ooo-ooi^o 
hjdm ooorx-ooorioooooo© © -o o> © o o o o o «r © © «■ o cn N«mo 

•h e>> niiionwon»>noo-onon w in •-< rs v is 



O CO 

■rt >o »< o cn w > w 
m r*> rv »h is cn -o 



«T CM CD 



JJ01 JJJJ JJJ JJJJ^ -I -I Ji -I —I — I — I — I ^ *■ 

CC CC ^ (L CC C£ CC QC OL IX. tZ (£. CC &CC Ct U. 0£ C£ <£.<£.<£.(£. CC l£ 

t-KCOKH-^-KI-t-t-t-1-K-t-K K t- t- (- h Hl-H K t- 

<o -o n» <oin-o-<><owcN(nwininininin>o >o >o cn -o <o 

ui zzHWZZZZMZZZMZZZZznnzMriZMMZriMnzror»jnr)nzMzzznnwMzr)Z 

t>s«r<i<iou<i<t'i<£u<l<r<tu-<i<r<r<i<lou<iULj<lou<luou<iuuLjuu<tL;<r<i<ruuuucu<i 
»*wi-i-«zi-i-i-k-zi-t-i-zt-i-i-i-i-zzt-zzt-rr>-zzzKzzzrzi-zi-i-i-zrzrt-zi- 

©OHJOOOO-OOOOO-OOOOOOOCNOOyjOOOO^OOOOOOinOOWOOOOO^OOO^OOCS 

•o ooinoooo-isooo ©wrocaowoooo-o mowoocooorsmooooin© in © <r 

o» oorsooocNi*>rsoo Mi».NONinoonM yioininoifi'O^NNOi'ioovo «r ©in 



CNMfSCNCNin hx9>h -* 






r*> in rs m in 



W CM 



UJ 

»-• ©oo©o©onoooooo©oo©oo©ooooooo©oooooo©o©oo©o©oooo©oo 



oooooooooooooooooooooooooooooooooooooooo^ooooooooo 



JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ 



nauua 

i i i i iniSiasanfflASfflCDAAaAafiiDAAaacBaai&aiBafii&i&anaaffi&fifflttAaAAn 
zxzxxxzzrxxxrrxrzczxrzzrxxrxx-rrzzrxzzzxxxxzrrxxxxx: 

osacfltaaooaocooaooaaoooaoooooaaoooooooooooooooooaoooo 

OOOOOUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUCJUUUUUUUUUU 



— XXiXit 

auuuu 
o <r <r <x <i 
x <& a a s> 



oi-t- 

CJ3 3 

n co u u 

o o cc 

ZZhl-Uhl- 
_l _l X_l _l 

fflsa«<i3<t<r 
x x en x x 
x z a. a. z ll a. 
ot a: co w o to co 
o o<x «x o « <t 



33 



u u 
a a 
t- i- 

3 3 

u o 



i£ •*. *. 

U U U 

<r « <r 

a a a 

k h t- 

3 3 3 

O O (J 



l-hl-t-l-l-l-l- 



_l -I 
X x 
to co 



-I -I 
<t <t 

X X 
u. u. 
CO CO 
<X <I 



<r <r <z 

XXX 
u_ u- u- 
CO CO CO 

<c <c <t 



id i£ -J 
U U _l 
« « >-< 

a a ■- 
co 

!-»-•-• 

3 3 a 
u u 
ct 

t— I— <x 

I 1 1— 

<t <t 

X X _l 
ul u. <I 
CO CO o 

<t <t u 



-jcocococococotncococncocococncocococococncocococncocococncococo 
uoooooooooaooooooooooooacooaoaoo 
zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

«x 
isaciosoaoaciaosoQosooooooocosoEtsc 



_l_l_l_lw_l_l_'_l_l_l_l_I_l_l_l_l_l_l 



I I I 1 I J 1 



UJUJLJUJUJUJUJUJUJUJUJUJUJUJUJUJUJUJUJUJLU 

— i ( i i ; i I ! i — i — i « — i t — i — i — i l — i — i — i 

aaaaaaaaaa aaaaaaaaaaa 



UJUILUUJUJUJUJUJLiJUJ 
I I I t I I I I I I 

■Xi tXi CCi JZi tXi £Q CO uCt dU 1X1 



l-t-t-!-l-h(-hhhl-l-t-l-t-l-t-ht-hl- 

cocococncocncococococncocococococococococo 

333333333333333333333 

1 *1*, ^***| ]T| jjj |3j p~j j2^| |*Q tXi *■& CQ <-Ci uQ iTi A 1X1 i~& i£i u-i 1X1 iXt 

rrxxrzrzzzzzzrrxzzzzz 

ooooooooooooaoooooooo 

CJUUUUUUUUUUUUUUUUUUUCJ 



cntococococococococo 

3333333333 

aaaaaaaaaa 
zxzxrrxzzr 

GQOQOOOOOO 

uuuuuuuuuu 



CD M r-) -< If) 

o cn ♦* r«i »m 

S, V V. V N 

CJ I-" — IN « 

v-l 4^ v4 O v4 
V V N. V N. 

<r t «r -o ^ 
rx pv p^ rv. is. 



M H N « M 
V V V V V. 

w o © o o 
\s\\s 

<r -o >o >o ^o 
rv rv n rv (v 



n r% rx rv i-n p* rx r^ rx rN rv rN pn rv rN ix i-n i-v i-s i-n i-v i-s rv rx nv rv rv rx rx r^ f^ rx i-k r^ i> i> i^ i> !■* n ■■* i> i^ i^» i^ i> i^ ^ i-n i> 

z <t<ocx<i-<")N^>-o:z<^aa«)j«ru(nNZjN£>-QOQj«HNS>4zjajNQi-Nj<iu 

O OO4ZU3OZNOZ<Z^O0)UZ<*>ZZKCI-<<<ZHUHH.U3<Z3^Z<(l)<<lllZ«<MI) 
M 



© 

OB 

o^ 

f-i 
I 

if, 

*-» 
l 

z 
<r 
-) 




a >- 

_J fiC I- 

W O Ul U "> 
itiCMlU 
JOU. U 

U It Ul 01 J 

3 a £ co _i 

OdCUJH 

a a: -i a x 



x cn 

<x _l 

a a _j 

-I <z 

Ul uC U. 

l-i UJ 

u. a x 

U. _l 3 

U30 

x a " 

co a co 



x cc C9 

<z uj <t ce 

a i£ m 3 
ucco 

lC 3 a z 

Ul lC Z <I 

z a <r i- 

O _J I- X Lt 

x 3 ce. ui <r 

MQO JO. 

a a u. <r co 



<I <t « <z <z 

CD m CN f-J w 

fl- 03 * &■ -O 

m CN o rs <r 
oooo© 

CM NNiHM 

«4 HWH O 

•-r * * 4-- «o 



<r a a <z « <z 

rv cv »< rx m © 

rt ^ o o IS Px 

>o in -r tv c-j m 

o © o © o o 

^ »4 n ro * in 

mnOOOO 

4f ■» >o >0 >0 >0 



oo 

Ul 

a 
o 
u 



-135- 



CM 



UI 

o 

0. 



U 

a 
o 



IIIIIIIIIIIIIIXIZIIIII[LLiIi.iG.ll.l.LLLIl.L1.0.iLLl.LLiLili.LLL 
I I I I I I I I I I I I I I I I I I I I I I I I I t I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxzxxxxxxxxxxxxxxxxxxx 
\nm\n\n\n*\nin\nin\n\nininin\nin\n<in\ntn\nininin\n\n\nininin\n^\n\nin\nmininm 



©000CM000CMCM0CMPICM00©00©00000fS000P-0©P.I«'P»©PJ0000©©©r>«00CM0PI 
CM NN NNN »* H NMH N »* CM CM 



NNNNN^^^INNN^INNMNNNNMNflM^N^P^N^NONfl(MNf•^f^MNNNN^PINN«NM^N 
N CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM rt CM ** CM »* CM «■» CM PI CM CM CM CM CM CM r* CM CM CM »H 



_J_J_)_I_I_1_I_J_J_I_I_)W_I_JJJ_J_1_I_!_1 

4«4<I'I«««<I<IiI<I««'Hr<I<t<I<I<I<[ 

oooooooooooojoqooooooo 



-I 
o 



-1 
<t 
a 



-I _l _J 

<r <z <z 
a a o 



i i i ■ t — ■ 

c <t <t « <c <t 

(300(3 00 



-I J 

o o 



-I -J 
a o 



<£ 
O 



ooocMooooom*oooo^ - oof-jooooii">ooMoc>ooK)cooooooinooooa)oorsoo»H 

ooco^ooooowO'O^'OomooTO^o -i rn in © rs o o in in o o in iv co v 

-lOCKO-rvNintiin coo>«r--H<rt*iininrim in o o n r* n >oo>n w pi 

w — <o oo m <o m Pi <o cm cm ro •«» >a w •» n inn »« 



-J -I 

a a: 



_i _i i 
cccccc 






ii i£ i£ 
12 CC CC 



«0 »0 >0 

a: O i£ O ^ SC iC 



<r cm «o <o>0'OmcM<o>0'Om <o-o~om-o «■ <o -o >o 

ooo3e:ooooooooo^oooooi;o^iio^i;j^oiiOiSi£Oi.wi.w<i.*.i. 

rowrozMwwwnwnwnzr'jmwMMzrozzwzzzMznzzrozMZKizzz 

uuo<tuuuuoo'_)uo<ruuuuu<cu<t<iu<t<t<ru<ru<E<Eu<iu<iu<t<t« 
xxxi-zzxxzxxzrf-zzzzxi-Zr-r-zt-i-i-xi-zt-i-ri-zt-zi-i-i- 

oooo40oooooosoonoononoooooooooiiinooooooooaiinooooooino 



_l Sti 

CC CC 

I- H- 

•o >o in 

Z M M Z M 

<£ O O <E U 

I- Z Z l-X 



I _1 I 

ce cc a. 



•c 

it © *: is ic 
z r«i z z z 

<r u « <r « 

hri-i-h 



O CO O CD <• © 

•o cm in cm in © 



inoooooo-ooooonm 



OOOOOOOOO-i 

obinnooonon 



«H WW rtHlrtrl * © rHNNMI 



U1 CM H o n N * * * 
iH CM CM 



»• OOOOOOM--IOOO 

*h onnooin hqoo 



O -O CM O CM 

i-l »H W tH 



O O <h o 

■•H © ■* O 



H< oooo©©ooooooooooooooo©ooo©oooooo©ooooooooo©ooo©ooo 
cc 

3 

-J 
z 



ooo©oo©©ooo©oooooo©ooooooooo©oooooooooooooo©oooooo 



z 
u 

a 

o 

o 

<z 

cc 

<t 
-I 
3 
o 



_l_l_J_l_!_l_J_JJ-J_J_l_i_J_J_l_l_!_J_J_i_l_l_l_l_l_l_I_l_J_l_l_l_l_i_l_l_i_l_l_J_l_l_l_l_l_J_l_l_l 

rxzrxzxrxxxxxxxrxrrrrxxxrxzxxzxxzrzzxrxxxrxrzxrxrx 

oooooooooooooooaaoaaooooaoGoaoaooooacooooooooooooo 
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu 

tncocntncnuicnmcncncntncncnenentfientnenmcncnenmcncncncncnencncncncnuicncncnenmmt^ 

oooooooooooooooooooooaoooocciococooooooooooooooccco 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

eaoaaocaoocoooaccccciacsaGSociccoccGcsoccacscciaoccso 



— i i i i i i i ^ ■ i i _ i i i — i r — i . 



_i i i i i f i i f i i ( ^ t ■ 



CJ 

o 
-I 

I- 
z 



UJUJUJUJUJUJUJIiiljJ 

i i i i t i i i i 

A AAffi ffiffl A AID 



UJUJUJUJUiUllJllilliUJIxlUJUJIlJIJlJIJUlljJllJIjJUUJLJIiJUJUJIxlUiUJUIUiUJIiJUJUJUiUJlliUiLd 

i t : i i ( i — i i i i i i t t i : _i t i i i i i ; ^ i t t i f i i i i t i t i ■ i 



l-^t-l-t-l-l-l-l-l-l->-l-l-l-l-!-l-Kt-l-f->-l-Ht-!-l-!-t-l-t-l— l-k-t-l-t-l-S-l— 

to en to en en oi en en en us en us en en en en en en us tn en en en ui en m en us en en en en en en en tn en tn us us en 
33333333333333333333333333333333333333333 
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 

xzxzxzzxrxzrxzzzzzxzzzzzzrrrzzxxzzxzxzzzx 

ooooooooooooooooooaooooooooocoooooooooooo 
uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu 



I- I- I- t- H I- >- I- 1- 

totncneoentrienentn 

333333333 

AAAtt ffif& A ffiA 

zzzzrzzzz 

ooooooooo 
uuuuuuuuu 



oo 

CM — 

cm «r 

in-o 
rs n 

o z 

u o 



N -CM «0 

O CM CM *h 

© HO o 

<on<o<o 

«VH _| 

133C 



CO 

3 

CC <E 

CLOOh 

UIZ 

u. oca 

ouso 

zij a 

o z_i a 

z ui<z « 



»h rs en rj on 

ui ~o tn * «o <r 

MMMCO *H O 

o OO o o o 

* «r <r a- »-i ut 

o oo o o o 

•o >o o •<> >o >o 



f» <r co 

CM CM CJ 

X \ X 

CM fl" T 

■rt o o 

V N. V 

m -o «o 

rs. rv rv 

a «i _i 

in >u. 



MnfflfflwfflnrtrtnTnicMflooMio-oonPir-iHMB^-onowoNrtrtrin^^M 

HOH-OONOOONMNrtMnNnMOrtMHOMHNHrtrtHMMONNONHOH 
NX\\N.S.\^vv > sS\%VV.\XXNV\V\ , V\NVVVV>vN. -, vVNVVV\X 

» in h o o> im<i »• o> iii 4 m o ^ in * w n h w w >r <r * m m m n w -( w h n m h ^j n h h n h 

OO^wOOOOOOOOOOOOOOOOOOOOOOO'rtOOOOOOOO'rtOO'rtO 

•o>ofsN«o<ocoNrv«o>ococo^'«^"«r<oin>oiiT>o<0'0>ouT<oii")-o-o-0'Oii'i-o«oinm'O i oui~o 
ivrvNNMvfs.rsrvisrsivrsr^rvrsfvrvfsNfstvf^rviv.rvivrvpvtvisrvrvivrvNNr^rvrvrs 



Tin jx«>ot-i- (0««w«v«i-«acc4> j i 

ZZCh-u.ZZ33^0.Ci.Z-IZM3CuZ<I3^<IZZ3UZZZ33ZCi.3KZZZ£Z 



•_jao«<rv>^>-'«i-<t«xavozk-< 



UJ LlI uj 

Ul _JliJ_IZ i£ z >- 

-I -i 0- to _j «-« ui z u. z o z en uj <e t- k 

> _l CS Ul m £Dm«ZOU1Il <C Li003_IUUI Z hZU Z 

i- ii zuii-Ofce >u<iq3jmccl£:3 ifi^ici-a juj >-i uoce ui 

•^ »-" >uuji-i-ujui»-a_iucczci.<i30_i ojo en z « 3 _i o en i- o a i- 

Uf_io_ii-uj£i:zeno>2-ii:ii:«i cc uazaz ziuzuizui^zt-i u.<rzot« _i « 

zuo ui(nooinuijQo<:oHU)ziiiujH(i)H uzHMHjHU(nu>> xoz^zzoo 

OOBCLUZU£OOl)(euCIUJhOhJKI-hliiulilCb.hhZic:ZZUiail.UlhHhifOli.K 

iccii.4:zuiJCZjOM<rzzj£zj£hi-injii:i-jzzQiJCjjii)jouZi:i£ji-zjj>>3i- 

0^30<E^00>-i UIulljJJ0«0<IlilU3H<IH>-)-HU<t«H i-i i-i O 3 O UlC<IZl£UJU 
U«uZJ«lL£K3JU33UUULA3AIILAa.JIAAAU3UiI3UlL3UIA<a(l)l-ZA 



«<r<r<z<t<i«<t<i<ra<t 
rj o co -o iv pi « in n cn co oo 

is n pi n n >o co o cmi < >o 

PI PI Plf^ON'OOHtT 
OOOOOwOOOOOO 
»H 111 llT 111 UT >-i •-! 0> O <T CS CK 
©00©Owi-iO»-<000 

•oo«o-o>orNrs>o-ocorspv 



Ul ^ *0 ^ o ^ H r-J ^ r-l H) T CJ CO 111 ^ O n rj iu i^ 'u ui v n ri nuj ^ v ui w 

ooooooooooooooooooocoooooooooooo 

ui nm cmii -o iii in iii n iii ri ui <f <r v n n ro pi pi pi cj ~a ci pi rs pi cm pi pi rj 

000000000000000000000000000»hOO»hO 

•o>ococo«r-o^v^ui-oui<-0'0'Oui'0'0-o»o-o-oin-oxjmin«o«oins> 



a 
r 
z 
o 

CJ 

a 
z 
« 

tn 
en 

<r 



A 

a 
ui 

t- 

C£ 
O 

in 



« 

en 

a 
cc 
o 
u 
u 
cc 



-136- 



Ill 
a 
o 



UJ 
O 

« 
Q. 



a.a.CLCua.<i.a.Q.xxxxa.a.o.xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XX X X 

in in in in in in n in in \n n in \n n in in in in in in \n \n in in in m \n in in \n in in in \n in in \n \n in in \n \n 



e> 



3 

~t 

o 

z 

>-■ 

cc 

3 

a 



o 
3 
z 



(D 



eo 

bJ 
CC 

3 



Ul 



Z 



z 



z 
o 
u 

en 

UJ 

o 

<t 
z 
« 
a 

en 

ui 



CMCMOOOOCMOOOOOOCMOOOOOOOOOOOOOOOOOOOOOOOCNCMOOOOOOOOOCMO 
CM CM CM CM MM CM 

NNNNNNNNNNNNNNNriNNMNNNNNMNNNNNNNPINNNNNNNMNNHMNNNNM 
NNNN CM CM CM CM CM CM nN«NNN(MNNMNNNNNN(Mf'IPI(MNNM NNNNNNMNN CM 



I l I t ■ I I I t t I t I — i — ( — t — i — i — i — i I f i i j i i ( r i i i ) — i i i — i i t ( i i j i — i — i ( t — i 

«<r«<t<t<x«<r<t<t<r«<t<i'<i«<t<t'«<E<t<i<r<r<t<i<t<i<r<r<t<r««««<r<i<t<r<i<ECC<i«c<t<i 

OOOOOOOOOOOOOQOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOSOtD 

ooooooooovvrscMOoeooocKOooooinwoooo^mo-ovocMooochooocjisoo©© 
©orsino©o©in«r* , ©* - tNo* , oor'io©©o©fsm©.-<©GO-o©©MrvN©ow!*)inommr*j©oo© 
aint^~*o*T\in~inrmr\ inoNMnMniii'OnHO'io o-ovot^idvocnosib ocovo-omoo 

n *4 <ONN * CM CM CM ■flMNNNrt — i 03 O OB <■ »■ "0 M MM CM CO rt II H N » 



-J -I 

CC C£ 



i- _J_l_i -I -J * -I -l — i r i i 

oc cccccc cc cc oc cc cc cc cc cc cc 

<L I- K t- h- H hh h ►— »— I— I— 

■o -o in -o •» >o -o -c -o »« low in -o in is o m >o>o>or-i-oin>o^ 

OOO^Oii^^OiSOOOO'-HiiOOiiitfOiiOOOjSii^^OliOiSOOOOOOOOOOOOOiiO^i; 
— ZMMMMnZMMZZPlZMMfOZZZZMZMZrOfOWMrOrOrOMMMMMMZMZZ 

OUUOUUUUUUO<C - J«<l 
ZZZZZZZZZZZ^-Zi-l- 



■o-0'OPi-oin'O'O'O-flmN'O -o 



WMnznzzzMZMMMMnznnzzpizronnzzzzMZMZMro 

uoo<tu<r<i<iu<iuucj'_io<ruu<i<ru<ruou<ic<i<iu<ii-j<rou 
zzzi-zt-i-i-zi-zzzzzt-zzh-i-zi-zzi:i-i-i-i-zi-zi-zx 

©©o©o©ooo©o©CM-o©©ooo©ootno©o©©oovoo©OM©©©om©o©©©ooo© 

nooooonooooonno om oo in © o o m o o co o o o ^owminwooeNno©©©© 

nO'OooO'on vi'O'0'0 o w n oo »*©»hco nnoinooo rswisivcNmo©<rcNCK©coino 



PI (M W O O CD • 

— n — 



on »« in 

»« CM 



W CM >0 •« »* »4 «H tH* 

CM »* 



Ui 

»-> oooooooooooooooooooooooooooooooooooooooooooooooooo 
cc 



-I 
z 



en 

z 
(- 
<I 

UI 

a 



ooooooooooooooooooooooooooocoooooooooooooooooooooo 



— • — t i — i i i ■ r i i f i i — i i i — i 



— i ( i i — r — i — I i i i I i I i ( t ( I 



— * — ' — * — ' — • — * -^ -~l — 1 _J — I — i — i— - —I — 1— J — 4 — I— ' — i— J_^ _f _u_j-^_j_J_j-^^_l_J _^ _J ^ _rf _J «^ arf arf _# ^ ^ 

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 

zzzr:czzzzxzzrzzzzzzzzzzzzxzzzzrzzzzzzzzzzzzzz 

000000000000000000000000000000000000000000000 

ouououuoooouooooooouooouuouuooouooooouoouuuuo 



_ j£| j3Q uJj uCi >-u 

zzzzzrzzzr 

— o o o o c 

<_> u u u u 



o 
eo 
c* 

.1 

in 

w 

I 

Z 
<t 
1 



a 
o 
z 
z 
o 
u 



en en en en 

o o o o 

z zz z 

a a o a 

HHMH 
I I I 1 

UJ UIUI Ul 

-I -I _l -I 

A A A A 



en en 
o o 

ZZ 

aa 



ui ui 
-i -i 

A A 



en en 
o o _i 

zz u 

a oz 

HH£ 
-J -I 

1- 

UIUI z 

JJi. 
A A » 



i 1 — I I I I 

o o o o o o 
cc cccc cc cccc 

hht-hl-t- 
Ul Ul Ul Ul Ul Ul 

iX a. u. ii. a. Li- 



en en en en 

3 O 3 3 

A A A A 

z z z z 

o oo o 

o oo o 



en en 

3 3 

A A 

zz 

o o 
u u 



*— i— <r 
en en _i 

3 3 
Afflu. 

:c z r 

o o o 

uoo 



_l -I -I _l -J -J 

HHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ 
OOOOOOwl-ll-ll-ll-ll-MI-H-IWl-.Wl-.Wl-ll-lWl-.l-lWWI-ll-lWl-ll-.l-ll-IH.WI-lWWl-ll-. 

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 
Ul Ul Ul Ul 111 Ul 

aaaaAa_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_i_/_i_i_i_i_i_i_i_i_i_i 

333333UU1UIU1UIUIUIU1U1UIU1U1U1U1U1UIU1UIUIU1UIU1UIUJUIUIU1UJUIUIU1UIU1U1UJ 
CCCCCCCCCCCC33333333333333333333333333333333333 
OOOOUOU.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.I 




<4xu)ijv<ixii)V)-v£yjo)«^«<ixz<ro>jjtiiu:<i<iii^oi(i:«NNtntuNiiiNci)N£C)-ii: 

ZQ.I-ZOwZ=«t-Z333Z3<:Z>-'Ou.>-il-f-«-Oj:<ri-iE<ti-iO<I<IEOu.<I<I^:^Z<IZ<IEM<I J £<I 



<t X 



o oct- 
t- hiec 

U. 3 Ul 

<r « a 

OC Ul >-• 
O A _l 



ct <r >i 

Ul Ul z 

A CC O 

i-i Ul > 

_l A3 



I- -I 

z >- 
> ZO X 
Z Ul z 

« x 3 a 
a en <c z 

JOlilC 

« o a en 



_i -J 
z z 



o 
oc 

3 iC Z Ul 

Ul A O <t o _i z o 

a ic ft z o z »- _i o cc 

mo cc * cc zz en a « t- o 3 
enoccuiz ui<Eozi-ici.z3aoA 
ccccuiacc_i3X>-<EX3>-ienz<xen 

U4.a jiujoviniitnjMMU^ 

5M2M^y<Huzrinii3X«0 
Ml^IUICiaiOlillilDOUlH 

ccen_io<icna.i-oAZ-:A_i_iu3 



ui 

-I * 

_l o 

M O 

3 CC 



Ul 

>- ui 

X 

w en 




z 

K it 

o z 

O 3 



Z UJ 

ui <r >-> 
en 



_i v- a v w k 



o 
o u 



3 CC Ul 
O O X 

-1 a. en 



z z 

3 3 

o o 
zz 

*: sc en 
z z cc 

3 3 Ul 

a 
>- > z 

1-1-3 

H H <I 

o o in 



u z 

o <I 

o o u. 

z o u. 

<r <i « v 

I3I-VU 

<r en ui z 
a. uj o z cc 

i.i;<iu<i 
<£ <X _l >-• Ul 

l-Jllli)£ 



Z 

o 

O -I 
UJ CC -J 

en _i 3 m 
3 _i a z 

OQHH1 

_i z 3 ui en 

J«IKU 
«U«MZ 
I- w. « X O 

en en z 3 -) 




O >0 CM 

O O »4 

(M m CO 

000 

^O <0 IS 



en 

ui 
a 
o 
u 



-137- 



<r 


UJ 

a 
o 

X 


XXXXXXXXXXXXXXXXXXXXXXXXXXX 

1 1 I 1 II ' 


XXXXXXXXXXXXXXX 

III IIIIIIIIIIII 


L 

I 


X X 


XXX 


X X 




Ul 

a 
<x 

a. 


XXXX XX 


X X X X X X 


1 ■ 1 I 1 • I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 II 1 11 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 


I X 


XXX 


X X 




ce 


«inininioinininin«inininininininvininininininininininininLoin 


in in in 


in in 






CO 
UJ 


NONOOO 


o oo 


o 


O CM 


OOOOOOCMOCMOCMOOOOOOOCMOO 


o o o 


© 


o o 


CM O O 


o o o 


© 


© O 


CJ o 






ce 

3 


CM CM 










CM 






CM CM 




CM 










CM 










CM 












CM 








-J 

HI 


CM CM M CJ CM CM 


CM CJ CM CM CM CM 


CM CM CM CM CM CM M N N 


n 


CM 0> 


CM 


CM O CJ CM CJ 


cj rj n 


CJ CJ CJ CM CM CJ CM 


f J CM 


M 


CJ CJ 


CM CM CM 


CJ 


N 






u. 


CM CM CM CM 


CM CM CM 


IN 


CM 


CM C>l CJ CM CM CM 


CM 


CM 


V4 


CM 


C4 


cj cj cj 


a cj 


CJ 


CN CN 


CJ 


CM CJ 




CJ CJ CJ CM CM 


CM C! CJ 




CM 






a 


-1 _J -J -J -1 -1 


_J 


_l -J 


_l 


_l -1 


J 


_J_I -l-J _! 


_l _l _J 


-1 


-1 -1 


_l 


-1 -1 


_l 


-1 _l 


1 1 1 


-1 


_l _l 


_l 


-1 _i 


_J 


-1 -1 


_l 


-1 _l 


_l 


_i _i 


-J 


_l 






co 


<t «« <r 


« <r 


a 


« <r 


<x 


<I <I 


<r 


<z <r <z <z <r 


<r <r <r 


<X 


•<c « <t 


<x <r 


<L <t « 


« « <r 


1 


C <E 


<z 


« <r 


<r 


<t c 


<I 


<X <E 


<r 


<i <i 


<t <L 






-j 

UJ 

ce 


oeoo 


a a 


CD 


a o 


o cd a 


CD 


O O O O CD 


CD CD CD 


o 


a a 


CD 


O CD 


o 


CD CD 


cd o a 


CD 


CD CD CD 


a o 


3 


CD CD 


3 


3 C 


3 


o a 


O CO 






o o in cm 


o © 


in 


O CJ 


o 


O O 


> 


O CJ M O O 


o o M 


M 


o o 


o 


o >o 


© 


o o 


© © © 


0> 


o o 


o 


o o 


© 


CJ o 


© 


© >0 


<T 


o- w 


© o 




<D 




OON» 


o o 


w 


o -4 


CM 


in o 


S3 


o n -o n o 


o o 0- 


CD O O 


o 


>o -c 


© 


T o 


© © © 


CM 


© © 


© 


© © 


© 


o © 


© 


© ii 


3 


-0 


© o 




iv 


i- 


no in 


o co 


«4 


- 09 


<*• 


»4 m 


M 


M3 o >o w n o 0> 


rv 


in x 


M 


4H M 


CJ 


o 


© © o 


G» 


Li in 


gi 


o © 


T 


r j o 


* 


M M 


<T 


X 


o 


M 




v4 


X 

<x 


CM CJ w 


in 


L0 


<r 






CJ 


•0 CM T 'O 


43 »4 


41 


«r 


M 


m m 


•43 


X CD M 4-1 


<3- 


•c V 


c 


4-1 X 


CJ 


L3 'V 


X 


M 


3 


"* 


n 






ce 


ce 


-J 


-j 


_l 


-i _i 




-i -i 


-1 


_l 3£ -1 






-i -i 


>e 


-i 


_J 


_l 


-i _i 




-i _i 


_i 






se _i 


•jL 


-1 


-1 


_l 


-J 






a 


z 


ce 


ce 


ce ce ce 




ce ce 


ce ce ce ce 






ce ce ce 


a.a.ce. 


ce ce 




ce ce ce 






ce ce 


ce 


oe 


ce 


ce 


ce 






£ 


n 


i- 


i- 


H 


i- t- 




>~ h- 


t- 


h- t- >- 






K H- 


H 


\- 


H 


H- 


i- t- 




i- i- 


H. 






i- t- 


H 


H- 


b> 


H- 


H 






UJ 


<t 


rv <o >o 


«o 






<© 






40 43 


lit 43 in 


-0 






•0 




•0 


w 


43 






in o 


m 






43 




•0 




© 




u 


h- 


kC OO O 


i£ O 


-£ 


i£ i£ 


c 


^ )£. 


■^ 


iSOiSOiiOOO 


o 


Ji ii 


^ 


o ie 


jl ie 


aeieo 


© 


jC X. 


^ 


o © 


© 


■^ iC 


iS 


O i£ 


Le 


Ji © 


se 


© 




UJ 


z 


Z MM M 


Z M 


Z 


z z 


M 


z z 


z. 


Z M Z M Z 


M M M 


ro 


z z 


z 


M Z 


z 


Z M 


Z Z M 


M 


-z.-z.-z. 


M M 


M 


z z 


Z M Z 


z 


Z M 


z 


M 




a 


o 


<I CJ CJ CJ 


« CJ 


<X 


<T <x 


CJ 


<E <£ 


« 


CU<IU<CUUU 


CJ 


« <t 


« 


cj <i <r <i u 


<E 4XCJ 


CJ 


<z <t 


<r 


CJ CJ 


CJ 


<x « 


<I 


U « 


<X <t CJ 


a 


U 




3 
0£ 


u 


H- XX X 


K X 


H 


H- t- 


X 


!- K 


w. 


l-XKXI-XXX 


r 


H. H- 


H- 


X 1- 


u- 


1- X 


H- H- X 


XI-(-l- 


X X 


■z. 


1- H- 1- X H- 


u- 


i- X 


H 


X 




en 


o oo x o © 


© 


o o 


o 


o o 


IV 


ooivoooino 


o 


o o 


o 


T o 


© 


o o 


ooon 


o o © 


o © 


o 


© © 


o o o 


111 O o 


o 


© 




X 


UJ 


o ©<r 43 


o o 


O 


o o 


o 


o o 


IV 


OOMilOOMO 


o 


o o 


© 


X o 


© 


CN O 


© © 


lH 


o 




o © 


© 


© © 


OlilO 


«r in © 


© in 




K 


X 


m *o <r co 


■** M 


CM 


in o 


CM 


■n O 


<a 


O >0 f J o 


O M O 


X 


o Ul 


© 


CS llT 


© 


O 


ui <r 


X 


o 




<r © 


CM 


o o 


o 


-4 O 


M x o 


in 


— 




M 


v4 


CM 


> 


»-) M 








r> -4 oo^n 




o 


n 


4-4 


Ul 


M 


-4 


rt 


o 




M 


4-1 


CJ CN 


UT 


in 


M 


•-4 ^> 


44 






X 


♦a. 
















O CM M 




M 






CM 








r* 








*4 


f-J 


CJ 












> 
»4 

> 


a 

CO 

Ul 
















CM 












































_1 
3 

-J 

a 

z 

HI 

ce 

3 
B 

CO 

f- 

z 
ui 
a 

M 


HI 

ce 

3 
-5 
Z 

HI 

(0 

X 

« 
UJ 

a 

CO 

CO 


© o© o 


o o 


O O O O o o 


OOOOOOOOO 


o 


o o 


© 


o o o o o 


o o o o o o o 


o o o o o 


o o o 


o o o 


o o 




© oo o © o 


o 


o o o 


o o 


o 


oo o o o 


o o o o 


o o 


© 


o o 


© 


o o 


o o o 


o o o 


© 


o o o 


o o 


o o o 


© 


o e 


o o 




— i — I 1 I 


_l _J 


_l 


-J _l 


-J 


_l -J 


_l 


_i_j_i_i_i_i_j_i_i_I_i_i 


1 1 J 1 I t [ 1 1 1 1 I 


-1 -1 


_l 


_J _J -J -I -I 


i i i i t 




AttAffl 


a ca 


B 


B B 


33 


B B 


CO 


iS A ffl ffi ffl 


Si CCt en 


69 


B B 


a 


B B 


B 


B B 


B B B 


B 


B B 


B 


B B 


B 


B B 


B 


B B 


A CR Si 


03 


B 




O 


« 


x r x x 


X X 


3 


X X 


X 


X X 


r 


xxxxxxxxx 


X X 


X 


xxxxxxxx 


XXXX 


XXX 


x x 


r 


X X 


X X X X X 




u 


-1 


a oo o 


o o 


a 


o o 


o 


o o 


a 


ocoooooo 


a 


o □ 


a 


o o 


a 


o o o o o 


O 3 C O 


o o 


3 


O 3 


3 


O 3 


o 


s o 


3 


3 




ce 

« 

3 
U 


CJ 


CJCJ CJCJ 


U CJ 


u 


u u 


CJ 


U CJ 


u 


uuuuu 


CJ U CJ 


CJ 


CJ CJ 


u 


CJ CJ 


CJ 


CJ CJ CJ CJ CJ 


CJ CJ CJ 


CJ 


CJ CJ CJ 


CJ CJ 


CJ 


CJ CJ 


3 


U CJ 


CJ 


3 




HI 

X 
UJ 

3 

a 

z 
>-t 

3 
-J 

a 


> 

HI 

a 
o 

X 
X 

a 
u 


1 _J 1 1 


_i_i 


-i 


-I -J 


_l 


-1 -1 


_i 


I 1 I I 1 f 1 I 


_i 


_l _l 


_i 


-1 -1 


_J 


i i i i i r i i i 


-1 -1 


_l 


_l _! 


_l 


-1 -1 


-I 


-J _l 


-1 


-I 


CO 
UJ 

B 

a 
u 


o oo o 


o o 


o o o 


o 


o o 


o 


oo o o o 


a o o o 


o o 


□ 


o o o 


o o o o o 


o o o o 


o o 


3 


o o o 


O 3 


3 


oo 


o 


3 




t 1 f 1 


-I _J 


-1 


-1 -J 


_l 


-i -i 


_i 


1 1 I 1 I i 1 1 


_i 


-1 -1 


_i 


-1 -1 


_l 


-1 -1 


1 1 [ 


_l 


-I -1 


_l 


-1 -1 


_l 


_J -1 


_J 


_I _ 


_1 


-i _i 


-j 


-J 


>- 


3 




uj uj ui u 


Ul Ul 


Ui 


UJ UJ 


u 


Ul LU 


Ul 


UJ UJ Ul UJ UJ 


Ui UJ Ul 


Ul 


Ul Ul 


Ul 


Ul UJ 


Ul 


Ul Ul 


Ul Ul Ul 


UJ 


Ul Ul 


LU 


Ul Ul 


Ul 


Ul UJ Ul Ul Ul 


UJ 


Ui UJ 


lJ 


u 


»- 


z 




3 33 3 


3 3 


3 


3 3 


3 


3 3 


3 


3 3 3 3 3 


3 3 3 


3 


3 3 3 


3 3 


3 


3 3 


3 3 3 




3 3 3 


3 3 3 


3 3 3 3 3 


3 


3 3 


3 


3 


HI 


hi 




U. L.U. U. 


u. u. 


u. 


Ll U. 


u. 


u. u. 


U. 


U.U.U.U.U.L.U.U.U. 


U. U. 


U. 


U. U. 


u. 


u, u. u. u, u. 


Ll 


U. U. 


U. 


u. u. 


Li. 


u. u. 


u. 


u. u. 


u. 


_ u. 


u. 


U. 


B 

O 
X 


01 




w no -4 


«r »< 


CO 


o in 


<T 


in cm 


■0 


oor-jin-OMMMMo>- 


<r in 


«r 


-1 43 


3 


CDCM»-rjinco4r<r<r 


m m 


in 


X X 


© 


in 4T 


43 O CD 


X 


49 


►- 




0«4HN 


CI -4 


-4 


CJ 4-1 


tH 


o — 


CJ 


"OONh 


■-4 CM CN 


CM 


O M 


© 


CJ -4 


o 


© CJ 


rj cj o 


-4 


4-4 © 


© 


1-4 T-* 


© 


© CN 


CM 


O CJ 


O 


il ^-4 


CM 


© 


X 


z 


UJ 


VN.X.X. 


X V. 


V 


V. V. 


X 


V. V. 


v. 


V. V. V. V. V. 


•x. "V V, 


X 


X X 


X 


X X 


X 


X X 


XXX 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


X 


o 


UJ 


h- 


0> O -O 111 


r-i t 


▼H 


CM --41 


IH 


r j in 


4T iv r i m cm «r co co ra m 


CM M 


CM 


CN M 


CN 


CJ M 


4-1 M CJ 


CM 


<r <r 


«H 


CJ CJ 


CM 


~0 © 


<T 


cj in 


w 


41 CD 


Ll 


© 


CJ 


a 


« 


o — o o 


o o 


o 


4-4 O 


o 


o o 


O 


000-4000--4 


o 


o o 


© 


o o 


o 


o o 


o O -4 


o 


© © 


© 


-4 © 


© 


© «1 


© 


o o 


© 


il © 


© 


■H 




HI 


B 


XXXX 


v. V. 


V 


V. V 


V 


V. V. 


V 


W V. V. V, 


XXX 


X 


X X 


X 


X X 


X 


X X 


XXX 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


X 


B 


u 




•0 <0 43 IV 


rv co 


CD 


IV 00 


CO 


O IV 


rv 


rv iv rv iv iv 


43 43 «43 


X 


CO X 


CD 


X X 


•0 


X CD 


X CD X 


X 


CO CD 


X 


X X 


X 


CD CO 


3 


00 CD 


X 


03 m 


3 


CD 


Z 


z 




rv iv rs x 


iv rv 


IV 


iv rv 


IV 


iv iv 


IV 


rv rv rv rv rv 


rv rv rv 


X 


X X 


X 


X X 


X 


X X 


XXX 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


X X 


X 


rv 


<r 




Z 


UZHCO 


ce x 


CJ 


CJ CJ 


> 


ce cj 


zcecozoce30<t_i 


-1 _! 


> 


JIU«CCCCC« 


CO CJ <x <t 


c ce 


l_l 


CO CJ 


cj co z 


X 


<x <t 


> 


ce 


CO 




O 


Z03 X 


« o 


Z ZCD 


z 


<t Z 1- 


<tXI-0«303 


HI 


u. u. z 


U.OZll-<ZZ<Zhi 


X 


Z wi. 


3 


H«3 


i£ CO CO iS X 


hiLiZC 


CO 

<x 
-i 
u 








z 














> 
































H- 










CJ 




K 














»- 














z 


















CJ 












a 




o 




ce 








« 


HI 




K 










UJ o 








-1 










"5 








> 




-i 


z 


z 




UJ 




-1 UJ 




CO HI 


O 




CJ 








u 


3 CO 




a 




3 




z 












a 


A 






3 Id 


o « 




UJ t- 


£ 


-J -J 




<t X 




Ul 


-) 








J 


a b hi 




O X 




CO 


z 


o 






IH 






ce 






h- 


Obi 


B X 




1- CO 


M 


•-> _l 




i-oa. 


Ul 


_l 










_l 


ce _i a 




o ui 




B 


3 


B H- 


« 




l£ 




■^ 3 


B 




z 


Z K* 


<x co 


> 


1- z 


I 


X i-i 




Z Z _l 


(J O <E 


> o 


>- 


B 


HI 


Ul 3 <Z 




3 I 




ce z a 


_1 CO 


H4 


« O 


^H 


z 


CJ 


B 


UJ 




Ul 


OUI3 


ce <t 


ce 


OH 


CJ 


3 


Ul 


z o hi uj i- ce _i 


U4 


Ul 


_l 


UI<C_I3UI30X>-UJUI 




o Ul 


H> 


Ul Ul 


B 


1- t- 


a 


z o 


<r 


en 


K 




B 


H _l « Z 


O 3 


a 


_l X 


<t 


CO CO 


u 


o CO X _l B 


Ul Ul _l 


z 


<Z _! 


<I 


*. -I 


LU 


CO hi 


a to 


3 


JJO 


_ B 


z 


HI _| 


3 


l-H <I 


CO 


Ul z 


B 


4H 


ce 




HI 


ZB3 O 


B 


i£ 


Ce 1- 


_J 


Ul Ul 


z 


t- -jl <t x <t 


r ciij 


Ul 


u. i—i 


u. 


ce b 


HI 


X _l 


3 <I h- z 


O X 


01 


3 O 


3 


u, ce 


3 


X ii 


— 


ce <t 


3 


i: 


o 




CJ 


Ul B _l CJ 


B 


CJ 


<r co 


<r 


Z h- 


3 


ccceuuz 


ae x x 


-1 


X <L 


U. 


<x z 


u. 


3 en 


b ce ce 


_l 


Ul H- 


_l 


<C B 


D 


Z <E 


_ 


o z 


z 


ce b 


3 


ly 


CO 




z 


2hh« 


-J -1 


M 


X UJ 


u. 


O « 


a 


<t <I a h- ce 


« O H- 


_1 


<t ce 3 


t- HI 


z 


ce ui _i <x o 


<r 


1-4 UJ 


Ul 


ce x 


ce 


HI I 


3 


hi <r 


— 1 


C Ul 


U 


<CC 




o 

CD 


1-4 


t- XX X 


ui a 


I 


U 3 


« 


~i a 


u 


aiiim 


X u o 


« 


1- B 


ffi 


CO u. 


Ul 


i£ _l 


<£ a. u. 


3 


ce b 


^ 


U HI 


B 


3 U 


CJ 


3 X 


3 


3 _l 


CO X 


LU 

ce 


o 


« <r <t « 


« <z 


<I 


<t <t 


<t 


<r c 


<r 


«<i<t<i<r«'<C'« 


<r 


« <I 


<c 


<t <r <t 


« <t <i <r <t 


<I 


<t <x « 


« <t 


<r 


■« <I 


<i <i -a 


<X 


<t <x 


<I 


<r 


1-4 


z 


o- w rt <r 


111 IV 


-0 


IV it 


•0 


o > 


tN 


co ^r rv cm rv 


in m m 


X 


CO CO 


<r 


43 w 


X 


0- 43 


O 4T -4 


M 


fl- 0* 


CM 


CJ CD 


T 


CI CJ 


X 


-4 <S 


-4 


O X 


rr 


3 




1 




m c j <r in 


M O 


M 


M O 


•0 


CD -0 


CM 


O CM O 43 IV 


M fl - CD 


CM 


in t 


^3 


O CD 


CM 


CD U3 


X CS 43 


>0 


CS ^4 


CM 


>0 »4 


© 


-1 © 


4J 


x <r 


43 


3 M 


Ul 


M 


03 


in 


H- 


hi © © CJ 


4-1 ll 


o 


O ^4 


IV 


in co 


CD 


^- <T >0 -4 CO 


OhN 


m 


ui r-i 


X 


in © 


111 


\n oi 


■o <r in 


M 


"J M 


M 


in © 




tH 3 


X 


CJ T 


IT 


M Ul 


3 


M 


B 


-i 


ce 


O O »h O 


o o 


c 


o o 


o 


o o 


O 


O O O -4 o 


rt --4 O 


o 


o o 


© 


o o 


o 


o © 


© o o 


© 


1-4 1-4 


O 


o © 


© 


-4 O 


© 


1-4 4H 


© 


— ii 


© 


-4 


ce 


i 


o 


cj »< iv >o 


-4 111 


>T 


<r 4r 


^H 


M UT 


10 


ii cm m ^ <r 


CD CD <T 


T 


n <r 


r-j 


•^ «r 


o 


CJ V 


cm «r 4i 


M 


»r •«■ 


-4 


-4 M 


M 


O •rt 


-0 


4H X 


n 


44 CO 


m: 


o 


o 


z 


a. 


OrtOO 


o o 


o 


o o 


o 


o o 


o 


o o o o o 


o o o 


o 


o o 


o 


-4 © 


o 


o o 


© o o 


© 


© o 


© 


O © 


© 


O -4 


© 


»4 © 


© 


-4 O 


© 


-4 


u 




UJ 

ce 


x >o-o x 


CO CO 


CD 


CD CO 


CO CO IV 


IV 


corvrv(Drv43~orv 


X 


CO X CO 


XX-OXCDXCDCBX 


o CO 


X 


00 X 


rv 


m oo 

• 


CDG0OXQ30DGDQD 


LU 

ce 



-138- 



IIIIIIILt.lllLLiLLt.LLLiLLLLa.a.Il.i4Lill.IIIZIIIIIIIIIIIIIII 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzxxxxxxxxxzxxx 
inininininininininintninrjininin^inu-jintnininininininininintnintnuTinm 



oooooooocmooooocmcmocmcmoooooooooooocmoocmcmcmooocmcmooooocmocm 
(m cm cm cm cm cm cm cm cm cm cm cm cm 

cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm m cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm 
cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm cm 



z 

UJ 

a 
w 
u 
u 

<t 

ft: 

«x 
-i 
3 
u 

W 

X 

Ili 

3 

o 

z 



o 
=> 
z 



en 

h- 



t i _j i i i i i i i i t i i i i i r i — i i i i i i i i i i i i i t t i — i — i — i i i i i i r i i i ■ i i 

<E«<r««<i<:<i<i<r«<r<i<t<r«<t<t<t<ic<t<r<t<i<i<r«'a<t<r<i<r<i<r<t<i<r<rc<i<r>x<i<r<r<i<i<i<i 

OOC3OO(DOOOCOtDC0COOOO(DtDC3C3(5OOOC0OtD[3t3C3OOOOt3OGaOOO3O(3OOOO 

oooooooooooMoooooooooo»Homoi>ooocDOo*rooomoo<rmooo'>roooo 
m©in©ootn©^o©-oowco©©©ouT©NO'rtOT©©in«r©©<rinr.J©ii-)oocnrv©cor!©o©o 

cm o o © cd cm o ro © in in in cm <o cm in cm w © <r in o © in w go «r tn rv cm *r is o- m m « ri in w o <o © cm w o 
in cm in «r <r *■ w n n <r n m * hj >c rv v w in. » < « n v n c< -o in n S3 <r rj » •< n < 



i 1 1 — _i i i _j _i_i 

CS. CC CC CC CC or cc CC CC 
H I- 0, I- H H I- t- t- 



'*. JZ. jL XL 

•Z.-Z.-Z.-Z. 

I- H- I- H- 



* ii -i 

cc cc cc 



is: i i i i i i 

cc cc cc cc cc cc cc 



_l _J *. -I 

ft: ft: cr oe 



in 



-I _i 
ft: ft: 
w i- 
>o vj in 



-o -o «0 S3 W CM 



sQ if) Ml Ul CM X) S3 ujxj -vu.i"v , *j , v'vujii 

li^l^OX^O^liiiSOOOiC^^^^^^O^OilJi^^O^OiSiiOO^OOOOiiCiw 
Z2•^M2•^r^222^^^^^'>Z222222^»>2mzzz;cLr>zr^zzw^oz^^•"■ | ■* , •* , "»■» r, •* , 

n*nrfffnn<ru 

zzzri-zz^-Ezz 



«_Z2l*)ZZMZZZMrOMZZZZZZZf*lZMZZZx-rj^n^^rjrj^r3r]nn^rjr3^^ir3 

■ rzzi-i-i-i-i-t-t-ri-ri-i-t-i-zi-ZH-i-zri-zzzri-Ez^-rz 



>ni-i-ri- 



m in >o 

MzrozzpOMznnMMznnzroMfo 

• • CJ 



o©o©©©o©o©oo©fsoo©o©©in©©o©o©©©©o©mo©©oco©o©ooooo©©©© 
oocooooo ooooorHiiiin©©o©-<©ooo©oooo©©fvoooo<r©oocDO-rt o©©oo 
mo oooom in cm o in o iv is o o © o «oooMO'Obiooi/iNooon<rooo cs rs o © ■« m w 



•1 w w © f*) 00 * 

~< w in 



onino 
cm cm in 

CM 



N © 111 CM CM CM CM li") i-l Hi © in 111 
CM -O CM w w M 



•^ >0 w IS 



111 

Hi ©O0©000000000©©©0©00©00000©0©©©©000©00©0©000000©©0 

cc 



O000©©00000©0000000©000000©0©00©©000000000©00©00©© 



I _l -J -I _l 



l_J_l_l_J_l_l_l_l_l_l_l_l_l_l_/_l_l_l_l_l_l_l_l_l_l_l_l_l_l_I_J_l_l_/_i_l_l_l_l_l_l_l_l_l_l 

CD IBfianffiffififilfiAffiffiAaCQAAfiffini&AI&iaASSAflSfflSAISfflfflfiCQffiSSAfljSffiSSfiffiffi 

•cc xxzx££x£££££££££££££xxxxxx££££££££r£££££xx£xrxz£££ 

-i ooooooooaooaooooooooooaoooooocoaaooooooaoocoaooaoa 

U UUUCJUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU 

in in in m in in m m in in in m m in m in m in in 

occcoccccccccccccccccclccccccccccccccc 
oooooooooooooaooooo 

H> 

HI CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM 

a 

O W — W W W W W W W « W W W « W -I W W W 0) 

Z Li 

z i i i i i !_i t i i i i i ■ i i i i i i i ■ ■ t i i i t i i i i i i i i ■ i i i i i i i — t — i — i — i — i — i a 

O HI WW li w M W M HI HI HI HI M HI HI W W W H4 HI w w HH HI W W W W W w M 1-1 1- 1-1 1-1 W W W w 1-1 HI M 1-1 HI HI HHHH O 

cj ooooaooooaooaooaooooaooaooooooooooooooaoooaaoooooo u 
i i ■ — i i i i r i i i i ( — J — * — i — i — i — i — i — i — i i f — i i i i — i i f — i — i J — i — c — i — i — i — i — « — i — r — t — i — t — i — : — i — f > 

WUJUJLdljJLJLJIjJWUULUWLdLdLUlJUJLULJldliJLdLULULdU *~ 

333333333333333333333333333333333333333333333333=13 w 

L.L.ltU.U.L.U,li-U.li.U.U.L.U.U.U.li-U.U.U.U.L.U.U.U.li-LuluL.U,U.U.U.L.U.U.U.li.L.^ S 

O 

mr»nrsNNfg5re>ww>oworjNfV5roBa)owvc^cnrsf^cac>wCM'<rc>>o-^ , inininrsrswoocM«orsworicnw £ 

© »* CM CM wCM«*©wr«3r*]Owro©©wwww CM OCMCMOCMwwwOOOwwCMCMOweMOCM wow© C I wwtMP) Z 

w c*oeo-ooooMO)'<nnN'Oi , )r)f'iaf l )i , !'HN»»»NMnH>cirifidPiNNOnc > ioNHNbi«i , iNrt-OH u 

•« OwOOWwwwO©©©©00©wwO©0©0©©00©w©0©wO©©wwwwO©©0©0©0©0 

a N.VS.«vXNNVS\s,SS > S.S.N.XVX%S.XXXVS s \N v > s \N.S > x , SSv > svv> v v.\-vS»vs s \\v s \v w 

cocoaja>oocDa3Nin>orsrxN>orsrs-oinrsrsiscDCDrso303CDCDrsiscnrsrsrsrsrss3rsis^ z 

^fSfsfsrs^^rs^s^^rsrs^rNfs^fs|s^srsls^^r^^s^^srs^s^^rs^srsrsls^rs[srsls|slsrs^ <t 

Z <UJJUU")l-H<)-<>B«<Ch4«EC0:'jUJ«J>JOOICHXC<<OOZ")J>-UJ3JJUNU en 

O O. Mm L. W Cfl Z ZZ 3 3 U * w(J o Z 3 O <E O k. Z w _| u. 3 U. O Z O 3 H- O > D- Z O w Z w Z W U. 3 U. « Z <I Z CO 

HI <Z 

H -1 

<t CO III I- CJ 

cj i- j x z 

O Z >- CC -JU M id LU Z > 

-i Hzzu u ui w <t ui o Lift: -13 ui a 

Z w o O w cc JOOO -I 3 lli O ft. JQ1C JO -I 

W Uil-liiUKh-iILiJZ > JJCCCC Z <t UI A <T O <I J U. U _l_IZwH- <t Q 

z z co _i w tn 3 uj ft: ui w_iwh> <ioz_i «u uiww _iui w w « j jomoj z a ui 

ui coui_i<cuiuiuiHiO en =>uizzuju]ft:3-iuizzuizft:zwiaz4Z 3 _i a: m u ui 1- cc h j o^om w 

Q UI -1 LU Ji _J _l CD C0>-ZOCnKUJUlC3UiUlOwuwUJw_|UJ ZZwft:UIZUiUiUJUIZ3Z(nUJZUJ<I..<-u<EUi CC 

w 3 0:i^fCiefiui£HiCM£<[uu{i-}u2Hju:^<iiLi-o3)-iiijoiu:BjouUHt3aLJuBi: o 

cj o«u«4<iHi:«ituauu >zoxirzft:3Zu.(nft:w_ift:zwuw3UJLi._ia.w3£02z = >-oa co 
z 3zo>zzft:<iui33Zi£0_i_i<io_iiouiuio<i:3 <tozo3wiB<t>-«ift:w<Eawui3_iui<roo«w 

w eucezucjA_iHiLLOw<cft.uiuicn£u<iZ3z_ia3uu.<Euuz<EZ3-iu.ft:3Z£-icnn3i-££Acn ui 

C£ 

O «4««<[«4«<E€«4aa<Cl9<C4<C4««4<I4:««««««<C«<tC««<iaC<C<C<t<C<I«<C«44 -I 

Z "OI'lHrt^inCMBCMllCOI'inVCU^TIllOUl'OMll^COMNCOrtOnnrilSO'ONVOT-OllTO'O'ONO'aiH 

«o is o o« >o sj w ut <r •<) ci <r ill m > o- s: -o en en n cm m n o r j * cm rv o rv o o cm w cm in cm m o c- co o m »• iit w ci m o en 

h innrtioaiffln'C'Oi'MoonnNfiToaiN^fiMitn^ri'OOHrtOrmiOTHO'ffcoi'iHOrtWM'i'OM a 

ft: OOOOOOOOOOOOOOOOOOwOOwoOwwwwOOwOOOOOOwoOOOOOOwOOOO ft: 

O O -I OS IV CM CM w Ci CM CM <T «T M N M f<l w fi M f*> CM CD in O <T CD N CO CM >C w n .Ci M f) M O w w O 03 CM <T S3 CM PI CM CM N C I O 

OL »HwOOwwwwOOOOOOOOOOOOOOOwOOOOwOOOwOOOwwOwOOOOOOOOOO O 

u ocgcoalDCDco^^^^^^■a^^^^^^^coaD^lgcocDl))^^o^^^^^'0^a)<o<a^to^^cDoa^co ui 



-139- 



IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIZIIIIIIIiLO.LiilLll.Lll.llL 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxzxxxxxxxxxxxzzxxxxxxxxxxxxxxx 
inininininininininininininininininininininininininintnininintninininininM3ininininininin« 



OOCMOOCMOOCMOOOO04OOOOOOOOOOO04OOCMOOOOOOOO0IO0ICMOOO04OO0IO© 
<N CM 04 CM CMCM CM CM CM CM 01 

NCMCMCMCMCMCMCMCMCMCM04CMCNCMCMCMCMCMCMCMCMCNCM04CMCMCM04 04CM04CM04 04CM04M04OICMCM0ICMCM04N 

CM CM CM CM CM CM CM CM 04 04 CM CM CM CM CM CM 01 CM CM CM CM CM CM CM 04 04 01 01 CM CM CM 01 CM CM 04 CM CM 04 



I I I I I I I 1 I t I I 1 _l I — I — I — I I — I I ! — t I — I — 3 I — t ( — ! — I — I — I : I — I — I — t — 1 — ! — I — I CT> — 1 — 1 — ! — t — ! — I — I 

0(3(5000 0130 000 000 000000(313 0(0000000 00(110008000 00(3150 00 




I I I -I -I J£ _l -I _l 1£ Ji£ -J i£ * 

cccccc cc tc tc tc cc cc cc cc tc cccccc 

t-KK I- I- I- I- I- t- I- I- h- I- t- I- 

■o -o •av^am-at^'O'a-a*) in •o<o-cio •« in <oif)M3in<oui'0'0-o«o«o >o in >o >o ~o 

OjCiClCO^OOOOOOOOOOiCOiCOOOOli-OOlt'OOOOOOOOOOOiSiSOiiiSOOOOiiJ!:^ 

nzzznzMMnnnnnnMnznzNnnnzwKZMriMni'iiiniinMMZznzznnMMZZz 

U<I«CU<IOUUUUUUUUU<ZU4UUUU<IUU'<CUUUUUUUUOUUC<ZU<Z<ZUUUU<E<I<C 

xi-i-i-£i-££££££££££i-£H££££i-x£i-£££££££££££i-!-£i-i-££££t-i-i- 




© 

CO 



I 
in 



to 



a 

o 

£ 
£ 
O 
O 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



-J _l _l _l _l _l _l _l -J 



I r — i — i — i — i — i — i i t i i i ( i i i — i t i i ] _j — i c I — j — t — i — i — i — i — i — i __t — i — I — ( 



AffiffinttfflaaffliSJ&aaAfifflssi&fioafflfflfiffifflAffiiBfflffitQacQffinfflfflAffli&i&aAiikAAaAA 

£X£££££££££X££££££££££££££££££££££X££££££££££££££X 

ooooooooooooooooooooooooooooooooooooooooooocooooaa 
uuuouuuuuuoouuuuuuuuuuuuuuuuuuuuuuuuuuuuouuoouuuuo 

m in in in in in m m m m in in m in in in in m u-> m m in in in in in in in in w m in in in in m in in in m id in in m in in m in in m 

ot cc ac cc k cz c& & cc x cc cz cc & <z cc cz cc k iz<c cz ce ez ce & it cc cz cc ct ce & x cc cz & cc k cc cc cz ce cc cc. <z cc cc x cc 
ooooooooooooooocooooooooooaoooooooooooooaooooooooo 

CMCMCMCMCMCMCMCMnf^CMCMCMCMCMCM04CMO40ICMCMCM04CMCMOICMCMCMCMCMCM04rMCMCMOICM04CMCMCMCMCM04WM 



I ■ I ■ ( I I t I I 1 — 1 f - 



— I I I I I . 



. I I I 1 t I ■ 



ooooooooooooooooooooooooooooooooooaoooooooooooaooo 
— i — i — i — r — i — t — i ( i i i t i i i — ( — r — i — i — i — i j i i i i i j i i i i — i i r i i — i — i — i i — 4 — i — i — i — i — i — j — i — ( 

WUJUIUIUIULdLUUILdUlUUJUIUILJUIljJWLUUJUIUILdUIUIUiLiJUIljJWUIW 

33333333333333333333333333333333333333333333333333 

l*.lilvliliU.U.liU.U.U.UUlj.U.Ull-UUIiU.U.U,lj.li.liLvU.U.U.U.U-U-U.(j.U^ 

os «r in in v 

V V V s. V, 

Ps * 111 CM M 

© o o o o 

V V X V V 

>o rx in tv is 
is rv n ts ps 

(oocoj«>aii)ozo><[«>-o>uu«t5in>->.jojiJz«jo«HHii)3no>-«««ua 

^<IU«3^«)^UMOZ^03»lZZZDi30£Z3iiL.04Z<tIiii:OZZr30iri:ILOZZ 




CD 

J Ii4 
-4 O 

« cccc 

U. UIO 

I- Id X 
>- too o 

UI UI I- 
JBUJ 

« x<r o 

> (J -I £ 



in 

o 

z ui 

MO 

CC Z 

u. <r 

co cc 

a 

£ 
3<X 

O _1 



(J -I o 

<r z 
a cc m 

HU J 
Cl 05 CC 
<t M 3 
CC _J iB 



U4 U 

-J -4 

_l _l 

M CC w 

Z> UI D- 

en <c u > 

z a. z cc 

<r £ ui cc 

r> <r cl. ui 

ui >- co a 



> 

H 
Z ii 

o u 

o cc a 

itlllH 

m 3> a, 

<t W <I 

U CL CC 



CC 3 

UI <x 
I- x 
en z 
ui >- o 

Ihli) 
O I- _l 
O i— i t— i 
CCX3 



u 

a 
a z 
z o 

<X li. 

_l 

X o 
o z 

M O 

X 



z ui 
ui o -i en 

* t- <t a 

t- X 4 <I OQZUH 

jc Zt- -4 co <r a z cc o :> l ui 

ui 1-13 ui o en j hliwoij en 

UI OO 0)3OHlilQiaZKi«Z 3 

cc iZKZiiioj^HzosHO ao<ra 
o co cnuio<rui<z u. m <t « x bi-i-si 

Hlil-iaiAU<ia3J(JUZI-Z03 
3 CL _i CC CO Z £. in C h a »-Z<ZO<CZ_l 

UtOO«OOUID'I«HI-l-3Hj;UJliJO 
Zi31UJUQI-ZU.ILlLliO(l)ffli:U 



CO 

a > 



cc u 

d. X 

CO CO <E 

•« o 

iC CO 3 

cc z a 

o <t <t 

> i<C CL 



o 

£ CC 

«ZhO 

zooraiL 

<E I- O C0 CC 

CC CO LL UI o 

a t-ii ii a 
_i t- u _i _i 

HHQH^ 

3 L CC 3 3 



CO 
Ui 

a 
o 
u 

i- 

a 
o 

£ 
£ 
O 

u 

a 
z 
<t 

CO 
CO 



« <t <t <i <t <t 

MhhMBN 

o inrs. in coos 
iii o <o in o ui 

O O O O -h © 
o. w n M 04 to 
O © O O -h o 

M)NQ) 111 Nffl 




-140- 



O.LO.LIlt.l.La.LLa.a.LLLLLLLLl.lL0.LLLZIIILlLLILLZIIIILILLZIlIIIZ 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 
\ninn\nnn\nininnnin{nfn\nmnintnnn^in\n\n\n\nnininin^inninin\nin\nin\ninn 



0) 

ui 
cc 

3 



©OOOOCMOOOCMOOOOOOOOOCMCMCMOOOOOOOOOOOCMCMOOOOOOOOOOOrvONO 
CM CM CM CM CM CM CM * 

CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM C J CM CM th CM CM CM CM fa CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM M CM CM CM CM CM CM rv N f» 
CM CM CM CM CM CM CM CM CM CM CM CM CM M CM CM CM »< CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM *4 ~* 





a 




en 




-i 




w 




a: 


CO 




IV 


t- 


0- 


X 


*H 


4 


<r 




Ui 


CC 


a 


z 


X 


l-< 


Ui 


« 


u 


1- 


UI 


z 


a 


o 




(J 


3 




(C 


cn 


X 


UI 


1- 


CD 




« 


P) 


c 


N 


<x 


0* 


B 


»< 






en 


> 


UI 


-1 


w 


3 


a: 


-> 


3 




-) 


Q 


Z 


2 


w 


t-i 




£C 


cn 


3 


X 


a 


»- 




<t 


in 


UI 


K 


a 



t I ■ ■ I t i I ? i t I r I — : I — T — * — l — i — I i i [ I I I r l — i I I I i — i — I — r — i — r — I — ! — I — I ; i i 

««««««<i<t<r«<i<z<r<t«<i««<t«<t'a<i«<r<r<i<r«i<i«<r<t««<i«<i<n««««««<i 

O'-ioovooowoo'VO'-ioriofi^nrN.ooooooooriirtOi-iomoocDM'roBmrsooiiTOooo 
n*-ooo-ooo'»UTUTC»'0>oriofvr , xp)r , )ooinooorvouTMO*oivoo«r>0'0^--<fs mm 
cscm vcmwoocmw cm mi wveo w w -» o iv o- n m cm in co m © cm in n — -« o o <r ~ m o- 
n n ■*■ <rw ~* w t MinMn»'0»9' -« in -o n cj « n ^ 




CC 



•o «0 

Z M Z M Z 
<t CJ « U C 

hth£l- 



^ o © -jl 

z w rr> z 

<r u u <r 

i- x x i- 



x 

cm m id 

r o o o 

Of u u o 

a x x x 



•oooooinoooci9>oooooo«oomoooooooo>oofnoooooocBocMOOoooooooo 
innno coo-ooo^oo o o in m wo© ©o©o©c*o©oin©o©©iT>©o©©©o o ooo 
*• in © o en *• »* o oo oonm rio-o inoaiooNOi/)oiiiinvooMi'i0B«oflB»H in t^o 



W HP)rl 



n 



© M 
CM 



m w in 



>-• cm «-■ en -o -c -c 



« oooooooooooooooooooooooooooooooooooooooooooooooooo 



ooooooooooooooooooooooooooooooooooooooooooooooooco 



UI ( — f l I — s f ■ i i i i ( I — i — i — i — r — i — i — i — i — i i — i i — i i — i — i — i i — i — i — i — i — i — r — i — i — i ( — r — i — i i i 

a cn . - . - 

l_4 (A AffiffiAAaAAAAAAhQAffiAAl£aAAAaaafflAffi£QAffiAai£AffiAi£AAaAaAAa-J^_J._l 

U <£ X XX X X X X X X X X X X X X X X X X X X X X X X X X X X x r X X X X X X X X X X X X X X X 

u _i 0000000000000000000000000000000000000000000000 • • • • 

« U UUUCJUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU.U.U.U. 

cc mwminwinininininininininmininininintninininininw jjj 

<t UI u u u 

-i cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc cc at cc cc a: z _i _i _i _i 

3 oooooooooooaooooooooooooaoa ouuuujj< 

o t- >-> w z 

w >• <■»*■*»**■*■*■*•* *■ *■ «• * * T ▼ * *■ *• * * * <r *•*■ ui_J_l_l_li— i— I— _i_j 

xi- KOOoominu.cju 

UI — CMCMCMCMCMCMCMCMCMCMCMNCMCMCMCMCMCMCMCMCMCMCMCMCMCMCM CC CC CC CC >« >-<<L 

=► a jKHhi-aaztinn 

O -• -4 — ^ ,-. ,h ~* rt _ w rt « -< ■- -i — rt -h -• « ■** — — -i rt — ^ v ui ui ui ui oo 

o x x a. a. a. a. x x x z z 

Z X _l -I-J _l _l_l _l _l _l _i _i _l -I -l-J _l _i _l J _l J_l _l _l _l _l_l UI Ui UI UI Ulld UI UI UI <X 333 

m o »-i ii m m m i-i w i-i >-i i-i i-i ii <i ii ii i-i i-i m i-i ii t-i m i-i ih i-i >-i i-i z z z z z z z z z to cn in to ui ui ui i- i- ui ui ui ui 

Z> CJ OOOOOOOOOOOOOOOOOOOOOOOOOOOUiUiUIUlUiUIUlUiUi-IOOOO_l_i_IZZZZZZ 

^ tncncncn(ncncncncn>zzzzooouiuioooo 

O _i_i_i_i_i_i_j_i_i_'_i_i_j_i_i_i_i_j-j_i_i_!_j_i_i_j_iooaooooaax cccccoz>h-i-i-*- 

z> uiuiuiuiuiuiuiuiuiuiuiuiuiuiuiuiuiuiUiUiUiuiuiuuiuiuia:Li:a:a£a£cca:LeL£»-_i_i_i_ii-»-i-_i_iuiuiuiui 

Z 333333333333333333333333333UlUiUIUiUlUIUJUiUiUI»Hi-ii-ii-iUIUIUI00UUUU 

m u.u,u>u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u,u.u.u.u.u.u.^^:^^j£^j£jC^xooooa.a.a.cncn<£<x<z<i 

at NoncOrtn<»N<in'Oin'(i-'«o-oN*if)coflorjinwinNHiii>oin(DoaiW'<co^-ofrOHi<irtrina)<iffl 

ui >- *CMiorvcM^^o3Nf>iri-i^cDoTCMonrvrtvv^n>^^Mr4oriorirt^w^s3rimc>CM-OMcouTi-ioo-iN 

a « 0000»<»NOOOO^OOOOO'HOO^OOOOOOOOO«HO»<0'^00-<0-<00^000000'rtO 

u rvcocorxivcDcnivojfN.rvo3rvNcocBCDcorvNrvcorvmivfsrvNNQ3CDK)orvoo 

Z isrvr^NNrsNrsrsNivfN.ivNNrvrvNrsrs.NNNrsfvrvrx^rNrvNNNNrv.Nrvispspvfsixiv.tvrvivNNfvrv 

H 

Z >->->-««NV«>-«i-i'««z>-a<r-)xuiv«_i«xtMoooz_ia>-ouii£Xx>i£i<:xa;nazx<txo 

O ^ZZO.CL«30.Z0.333X^Xa.ZOXi£>«a.O<CZZZI-U.cnZUXOO»-30400ZXi-iZUI-cn 




a u 

X. z 

O <L Z 

O Z _l <z 

X UI 0£ C3 

<t CC Ui >- 

_ <X OJ X 

_l 3 X U 

HUI3H 

i- cn o x 



z z 

Z O ii 

o >- i- a 

i-.cj cn _i 

>-'<z 3 3 

3 l£ O <E 

cn i- x x 



cn 

o 
u 



cn 
cn 

« 
_i 
u 

>- 
a 

a 

Ui 

t- 

iC 

o 
cn 



cc 

•a 

cn 
a 
cc 
o 
o 

Ui 



-141- 



IIIIILLLIIIIIIIIIIIIIIIIIZILIIXIIIIIIIIIIIItllllll 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I- 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzxxxxz 
inin»inin»o>oininininininin>oinioininininininwininin«oininininininininininNOinininin«oinininintnin. 



OOOOOOOOOOOOOOOOOCMCMCMOOOOOOOOOOOOOOOOCMOOOrv.OOrvOOOOOO 

M CM (M (N ** -* 

^NN^lN^lNN^N^^^l^N^eNNONN^l«N^«N^^lNNNN^Pl^lM^l^M^N^c^«p^r■lr^N 

^CM(NCMCMCMCMCM**CM»*»* •* CM »* NNNn«NMNW»<NNNnN»<ri CM CM •< »m CM CM CM CM CM CM CM 



a 

CO 



I I I I _1 I I _! 

« <r «x <t <i « <t <x 

oaooooo o 



co jj jjtn jjj j jj j 
a <x<x<r<rfli<r<xti<x<x<i<r 

j OOOOJOQOOOOO 



_l -J -J _l -1 


1 ■ 1 1 


_l 


en _i 


_i _i _i 


<t « «z <r « 


<x « <r<t 


« 


n <i 


<r «x <r 


CD (9 O O CO 


oooo 


a 


O CS 


uoa 



ce OBNiioooiiiOHOooS'OOOOMOoof^oooiioooooooooHcoooiiio-iiiooon 

CD N © CM O 11 O CM [ft OOMhIAOVh h PIh 10 OOOOO WO O W -O © CK 10 

Nh- <c cn cm 'T-c in v in I s * «t »« -o cm iif4'cnn nv o r* »< cm »* 

»>x wn n m i«> »< o*x < eg <o<o<o ><n n 



-i * 

ce ce 

i- t- 

vQ >o >0 "0 

it: o o o © i£ 

2 M P) M M 2 

« "" 



CO 



_l -J 
x i- 



_i_i 

t- 1- i- t- x a. 
.inrx in xx n -o -on >onnn 

ii o o o o © x o ^ x o © _i o o o o *.*. 

2MMMldM22W2«23Mr«)l-MMMMlil32 



J£ _/ J' 

ce ce ce 



hhl r X I- X 

so N-N-nirrz ie x 

X'^O^^^O^OOO _l 2_IX X 



© © O © ]£ ^ © O O © O^OXS©©-!©©©© E.£©:i£i£i£©-<000 _J Z _J C £ 

wnwM2 znfifiuMZznznzsfinHMMnniiiszi'.zzznnnpinzzHUMDZDci 
oooo«N«ooorvo«x«o<io<iceooooooorvce«o«<x<iooooo<t<x-<CN_i<xce<XLe p«.n 
xxxxi-wi-x x x»-i xouxi-xi-arxaxxxX'rtiaKXKi-i-xxxxxuuii.iHiSici.a o o m~< 

DoooooooooooooooooooooooooooooowooooincM©©©© 
d-ho ooooooinwow o^o oo«oooooo on oom> ono 

3 -i nrtONinoMioro o »h o««ooo>oo o w t ■»■ «r on© 



oooooooooo 

OOOOO O O © <i 

in cs© in o ooo 



in o 

cm *« 



m »* o o o in cm 
»-« in n *r 

CM 



M o oo o o o o oo o oo o 



OOOOOOOOOOOOOOOOwOOOOOOOOOOOOOOOOOOOO 



ce 

a 

CO 

I- 

2 

lu 

a 

l-t 

u 
u 

♦X 

ce 

<t 
_i 

O 

H 
X 

o 

2 



OOOOOOOOOOOOOOOOOOOOOOOOOOOOOrHOOOOOOOOOOOOOOOOOOOO 



-J_l_l_l_iJ_IJ_l_l_l_l 



JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ 



LLLuLLLuLL.li.LvL.U.LLLLLvL.L.L.L.Lk.LLLi.L.L.u.L.LLL^ 



b. U. U. U. U. 



con co co co en 



Ul 111 • • • 



<r 
u 
o 



-1 -I oo o ooo 

!■* M •• • •• • I 

OS CC 22 2 222 



• eococococoiocoencocnco 



oaooooooooo 

22222222222 



LU UIU1 Ul 
2 22 2 

o oo o 

l-hl-l- 

Ul LULU u 

o oo o 
«t <£<t <t 



LULU LI LI 2 Z-l-l JJJJJJJJJJJJJ 
22220 OOO O OOOOOOOOOOOO 
OOOO-J JII XXXXXXXXXXXXX 
t-h-l-l->->-000000000000000 
LULULULUCeCCOOOOOOOOOOOOOOO 

OOOOO <L_1— J I I I i I I I f i t ! I I ) 

«X<X<Z<X<X<X<I«X'<t<Z<X«X«Z<X«X<I<X4X<X<C<X 



oo 

X X 

o o 
o o 
-I -I 

c <z 



en en 

• LU 

O I- 

- «x 

2 I- 

LU 

-1 o 

a <£ 

X 

O -I 

o > 

-J X 



* * i£ iS 

o o o o 

SffiSffl 



3 3 3 3 

o o o o 

t— I— I — I— 
I I I I 

<L <L <I >T 

X X X X 

LL.CUU.Ck. 

tn tn en en 

«I « <t <L 



* ~ ~ 
O _l _l 

<z o o 

ANN 
22 

KUU 

3 a a 

O ^ w 

I- LU LU 
-12 2 
<X LU LU 

INN 

LL. 2 2 

en lu lu 
<l a a 



o o 

N N LU 
2 2H 

LU LU <X 

iXl * H- 
s, ^ LU 

o 

LU LU <r 
2 2 

LU LU -1 
M N >- 
ZZI- 
LU LU 3 

n os o 



co coco en en co 
o do d d d 



2 22 2 22 



en 
& a n o a q o 

HHHHHHZ 

3 3 3 3 3 3 
CS GJ d GS O O (3 



en 

d 

2 

en 

a o 

i-i 2 



2 2 2 2 2 2 2 

LU LU LU LU LU LU LU 

X X X X X X X 

LU LU LU LU Li LU LU 

o o o o o o o 



2 2 

LU Ui 
X X 

LU LU 

o o 



en eo 
o o 

2 2 



2 2 

LU LU 

X X 

LU LU 

o o 



<o*rc^incow^ino 

00000^«-iO«-i 

rars.socoo'ocoon 
NN^is.r«.Nrsrvp>. 



cooNtnwcMmco^oa©mcNWoniNr*«on«oinmi*>cMfs,H,-t«T»'<r»H-cinmrif*>©chCh 

r I rn H r< pi h ri n h h h »i o fi rt n n n r j h o o m o « H -4 H rt rt o o m h h « f / n r-i « h 

MOON'«MrtrtrtNH^in'<)WOO>0'f^'<eDOfflOI)>N(DNI , )H|OONM»iffl<rM>.|BO) 
O-OOOOOHOOHOOOOHOO^iOOOOOOOOSOOHOrfOOOCiOOO 
S.NV.N. v s.%V>sVN s «.VS.NVVV.>n.n.N.XV.NS.\V.XV\N > s > sV>s. s ».N.\V.V>v. s >, 

ow*»rn«oinrscoNrN.offlr^NcommNoni^>orscocoiiTr>.rsco«0'<r'ruTU'iuT'OOD"Oeomco 
rvNrvNrvisrvrxrNNrsNisr>>r»rsNNrv.r^isrs.rN.ps.rsivNivisNrsisrvrN.fsrvi^rsistvrs 



o)o<aj4HZj£«>«<oia:«M4a>-(i)«ZHX«<jcLi-^iL5jh<iJzio«TToxzH<ix!< 

ieX0X«XM3M<X<I3>^Q.0X«I0XUX2X0MX»-a.»-)M<X30<X3<C3CL.«Xt-^02ZX L -M30t-K- 



>■ * 

t- O Ul 

MO -J ^ 

02 ce u -i o 

O 2_J m O 

•i -j zt-uioj> ce 
_i w 2 «eo _i 2m eo «2 



ui 
co ^ 



co 

Ul 

-J 

«JZ 

HH1E 

ce <£3 
o coca 

0. OCX 

x wen 
LU =><t 

<i«s<c<t«i<c«<r<x <r <t <t 
'TCM&.'HN'Oomin ~o -o 

»IH-OlflMOBPilNOHTHN 

no».rtOrti<)ni<i no-co 
oooooo^oo ** © o 
Mno>NC«rt ^<io noeo 

OOOOOOnhO^O««0 

MN-OOOIBMMfflMfflWT 



> 

o 



Ul 

=► Ul 

ui« m _i ce ui 

2 CC t— _J h- O LU _1 i£ 

« 2 OH O « CO A O « O -I <t JUZ ^. -c ^ 

■<zce<Ei-Luo<i-iceLU)-Li2eno<io 

: O <X X « _1 «X X LUujI-QLULUI-OX 

■ i . . jv t i f rt i m .,^ i . i tf, .— . i . i i ™i 



> 

w 2 
Z O 
CL 



CO 

X 

O 2 

O O 

ce >- k- 

2 2 2 




O I- 

ce ft 

LU2 3 O 
(SO tb 

x en en en 
<x ce lu <t o 

ce lu 2 en 2 
o t- m 2 <t 
<r<x <t <r _i 

JlLX^O. 



Ul Ul 

-I -I 

a -i -i 

_I HH 

LU K ^ > 

ii ce en en 

LL. LU <X LU LU 

■Z. 2 X *. ■*. 

lu m ^ ce ce 

LIUU«4 

ii <IO J J 

o ce ce o o 

<x <x a «x 

^ N H rt 

O 0» LT UT 

-< © in in 

CO O O 00 

o ~ o o 

>0 CO CO 03 

• • • 



a 

a 

LU 

h- 

Li 

o 

L0 

LU 
CC 

<E 

tn 

a 
ce 
o 
o 

LU 

ce 



-142- 



Id 

Q 

O 
X 



xo.xxxxxxxxxxxxxxxxxxxxxxa.a.o.o.o.a.a.xxo.o.xxxxxxxxxxxxxxx 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i t i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

\n\nncv*^nin\nin\nninin\n]nin\nin\nm<in\n\n\n\n\n<in[nnin[ninin\n\n<\n\n\nin\n\n'0\ninin\n 



OCMrvCMOrvOOrvOOOOOOCMOOCMCMOOOOrvOOOOOCMrvOOOOOrvOOOOOOOOrvOOO 
CM rt CM ^ r* CM CM CM «H CM «H r* -h 



CMCMCMNCMNWrvMNWISNNNCMW^CMCMCMCMCMCMCMI^CMr^CMNCMCMNCMC-INCMCMNNCMNrvrtCMCMCMCMCMCM 
CM CM w i* »4CM»H— CM CM CM CM C i .* CM »< CM CM CM CM CM »« «< »< ~ ■* 



-J -I -I -I 
(9 (9 O O 



_i i i i t — t — i i t i -i i i r en en -J 

« «<r<t<t<t<t««t<r <r <r<r« t- a « 

q OQQOOflOOQ j3 O O O O _i O 



ce ooow-oooooooocoooooMOW^oooooinoinoinocMorvooooooooooooooo 
co © © in o cm nincM^ooio n no in 

rst-^io* «« cm oio o 

r> X -O CM * CM 



OT -I -I -I 
Z H K K 
•i X XX 



Z _l X 

3IHH3 

or iv <t ce 

Qh(LO 



•o *: in 



X X 



O Z O X X 



-I 
I- _l 

X 1- 

X 



-J -I -I 

H- I- 1- 
XX X 

«0 
X XO X 



-i or 

K I- 

x rv -o -o 
^ o o o 



M) 
O X 



V CM CM CM -O W •« CM IT) If) CM CM CM 
OOOO^OO^OOOOOOO 



xxox ^000 *r ox 0000^00^0000000 

ro <i ro 3 3 A3ZZ22P13U zzniiii«azun3«affl»i>inwMZi , )nznpi«nni<in 

"<t«ceLeuii:ivi3B««cjaoiviv«rvufle(vrvivrvuuoo«tJO<tuuouuuL; 

Oi3Xa-Hin(JI-XXXrOrOI-»-Xi=irOrOrOrOXXXXI-XXI-XXXXXXX 



raiuanncuuu 



ooooovooinoooooooooo>>oinoooooorjoooooo-oooo 
ooinwocMoorom© wo * ro 0000 o» osjoh oooino 

oovnin o in uio o 01000 cm o o cm <r rv cm o 



o-oooooooovooooooo 

OVOOrvooMOO o 



«h o 



to in »-i rv 



rt-oin ro 

CM fv - 



— OB 



10 ro co »■< o cm m © o 00 in cm in m in 

^ — CM »* CM CM •* CM 



hi 

w OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 

or 



00000000000000000000000000000000000000000000000000 



1 1 1 ■ 



1 _i _i _i _i _i . 



1 1 1 t — 1 — i — 1 1 — 1 » i — 1 1 1 — j 



J — 1 — f 1 I i I t ! t 



L.U.U.U.U.U.U.U.U.UU.U.U.U.U.U.UU.U.U.U.UUUU.UU. 



.U.U.U.U.U.U.UU.U.I 



U. Li. U. U. U. U. Ll, 



HI 

a h- 



COOIOh 

o o z i- 

ZZHO) 
u 11 

o ao a 

M M Q 

_i _ior or 

<£ 
l-l-l-l- 

z zz 

Id UI Id _l 

x x x <r 

Id UI UI o 

u ou u 



U.U.U.U.U.U.UUU.UU.UUU.U.UUU.U.UU.U.U.U.U. 



1-1 a UI UI Ld Ld UI 

o 11 ;> :> z> :> => 

_l o o o o o 

I- XX X X X 

x a ui ui ui ui uj 
a z ae or ce ce ae 

_l Zhhl-HK 

z <t zz z z z 

KOUMHMMH 

«t-l_l«<t<t<t« 
t-acja.a.o.a.0. 

a 
_i_io.a.a.a.a.o. 
«_jzxxxxx 
oaaooooo 
uuuuuuuu 



UlUJUJldUJUJUIUJUJUJUIUJUJUiUiUiUiUIUJUU 
OOOOOOOOOOCOOOOOOOO-I.J 

xxxxxxxxxxxxxxxxxzz_i_i 

UIUiUIUIUIUIUJUJUlUlUlUIUlUIUiUIUJUIUJ>-l>-< 

t-ht-(-hh(-KI-hhhl-H-t-l-l-l-Oa 
ZZZZZZZZZZZZZZZZZZZ33 



xxxxxxxxxxxxxxx 

_I_I333333333333333 
UUUIUIUiUJUIUiUIUIUJUIUiUJUiUIUJ 

_I_I_I-J_l_l_l_l_l_l_i_l_i_l_l 
_i_jooooooooooooaoo 



<t<C<I<t<t<t<t<t<E<t<t<Z'<I<I<t 

iiLij.Li.0.u.u.u_LLu.u.u.u.a.u. 

ii-a.u.u-u-u.u.jl.u.Ll.a.u.u.u. 

xxxxxxxxxxxxxxx 

aooooooooooooaa 
uuuuuuuuuuuuuuu 



O CO ■«■ 

CM CM CM 

X v. s 
o> v <o 
000 

v» v. v. 

00 rv in 
tv rv rv 

« <t z 

OO.H 



«h in in «r 

X V v v. 

MIShN 
OOOO 
v. V, V v 

rv co in ro 
rv rv rv rv 

<£ <X O _1 

a. 0.x u. 



CM O 
v. v. 

CM O 

•v V 

v * 
rv rv 

><t 

30 



O ro ~ 

ro CM CM 

v. v v. 

^ in CM 

O O w 

v. v. v. 

in »r «r 

rv rv rv 

> <c >- 

z a 3 



n h - co co w 

O CM CM CM CM CM 

N v. v, v. v. v 

cm pi cm «h o- -* 

O -1 -< o o o 

•V V. V V, V V. 

S3 ^ ^ 00 rv rv 

rv rv rv rv rv rv 

«>->-«HU 

_i 3 3 O X Z 



NNOMOrtdNx 

VV.V,V,V,V.V"VV. 

cm cm «r rv o o »■ o cm 

00000»hO»<'-' 

V.V.V.V.-VVV.N.V. 

rvrvcorvcooou")'«r>o 
rvrvrvrvrvrvrvrvrv 

xx<r«z«_ixx 

OOOOKJi-il-t- 



<t <z « <t ae a: 

a. a. a. a. >- 1- 

Cl Ll. u_ u» u. u. 

x x x r x x 

000000 

uuuuuu 

ro rv ci -o rv o 

rt n - o - « 

v. -v V V. V^ V. 

«■< cm at in «r ro 

n-l TH O O O O 

v. \ 'v >v \ v. 

» -o rv rv in >o 

rv rv rv rv rv rv 

-I « Q ^ <Z X 

« 1-1 X O hhO 



a o 

3 3 

I I 

<r en 

>- i- 

u. a. 
X X 

o o 
u o 

ON* 
HON 
\ v. >^ 
* m ro 
000 
v x x 
co o in 
rv rv rv 

-J <X -XL 

<coo 



UJUIUJUlUIUIUIUJUJUJUlUiUIUJUi 

Ll.U.U.U.U.i>.U.U.U.LLU.U.U.LLU. 



I I I I I i I I I I t I I 



oooooaooooooo 

UJUiUJUlUIUJUJUJLdLdUJUIUJ 

0030300000030 

ouuoouooouuuu 



o o 

3 3 

o u 



O ^O ffl CM CM ■r* CM CM 

CM O CM O CM th 

V V. V. >v "V V. 

■rt »H ~H * ^ O 
OO^OOO 

V. N. V. v "V "V 

in in * m m ro 

rv rv rv rv rv rv 



\ v. 

O- CM 

o o 

^ "V 

in ui 
rv rv 



hOI-OI-l- 
3 U 3 U 3 3 



>■ > 
3 3 



a rv ih iit 00 co 

o ^ h n M N 

V. V V -v "v "v 

t^OMhO*. 

»h ^ o o o o 

■v. V. V. V v. V 

■* «r iiT in * v 

rv rv rv rv rv rv 

)- <t t- 1- 1- t- 

3 O 3 3 3 3 



at- z 

o z >-• <r 

t-O 3ZU>- UI CO UI 

or 3 « o 3 1- wo « 3 co _i en w or 

— or z z ui 



X X 

u u 

z z 

ui o o 



UI 



o »- 

ui or ui ui a 

I-003 ZmDuuZ O 

ozzoooorazz>->uio 




> 
uior 

zo 1- 
hh a or 1- 

HUI 3 >-• 

« _i I- 3 

u a <t o 

oiau j 

3muO 
X X B U 



« 

u 

t- UI « 
Z Z X 

CO O CO K 

Z«HI3 
O I- <x o -c 
x _i or 3 w 
1- <r o a x 



z 

O 

>■ 

I- Z K 

z « z 

o u z or o 

x o o ui x 

«MJtQC 

1- o 0: Z I- 

_i or <x <t _i 

<r a. u. _i <l 



a 

_i >• > 

UI hh 

*-* H K »■* »^ 

U Z Z U O 

in o o 

lc x x or cc 

ui <r <r ui ui 

<X _l _l UI UJ 

aa C <r x X 



<<t«ia<i<c«<i4<i<i<i<c>tio<i«««iB««««««a«ui<i<<i««<i<i«<:«<c4«<:<t«<i<(<iiii<[ 
o> ro m rv rv cm cm r j o. -o >o o <-i o cm > o> o» •-! w m cj rv rv ui ro m cm >o w ^ rv ro -0 cm 1-1 ~« o» o < «o >o 0- w o cm co m o o 
N^rv*nrowNO^tOM^nNO^rvcDiiTUT<TNC>rvM3>oo->ocooiiTf-jivfjrv<oiHfguTrvroooiorooroiorvrv 
CMininrio^ , rOrtrOrtOM3io-Ortrtrtrorjrioworoio»Hrvrvrt»<o^iii>OrtriPjrvrvrofjoror>u')too>o^roro 

<-«©00»hO©000000©0©-'*00©^»<0«-400©©0'' , ©000»<0©0©0©0©©0©00©0 

o in rv <r o cm a ih o r 1 cm pj r 1 c j -< cm ** N ro ro * «o o o ^ cm ^ ** w rv * m in w ■» ^ «h cm <t cm o> &■ ci w •- ro cm o o 

^OOOOO0O«iO^i«O»H0000OOO0O»H^-i-H-<OO00OOOO0O»-iOOOO0tH T <OO^-< 

orvinivmuTnin*inv*^*inoorvrvrvmrxocon*>o*rvrvrvin<ominuTin*ininioinin'r<ruTbT'*fl- 
• ••••• •• 



z 
<i 

en 

en 



>- 

lD 

a 

UJ 

I- 

l£ 
O 

tn 



-143- 



Ill 
o a 

•4 o 



xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxa.a.a.a.Q.0- 
i i i i i i i i ( i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i* 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



cc nnin\nn^nn\nin\ninin\n{n\nnin\ninn\n\ntoin\n\n\n\n\nn\n\n\nnnin{ninin\n\n\nininin\n\nin\h 



ooisoooorvoo^.ooooooooisoooooooocooocjrjnoofjooooooo(voooo 

*4 " vt r* n PI Pi PI PI « 

wrspirsisfsp4CMCMCM^Nrsp»p^r*NNispiNNNNrspjpjpipipjpjpjNPipjpjpjpipipjpipjpjpir,ipjpjr'ipjpj 

CM *h w ~4 .4 NridriMrirtMfiM HrtrtrtrtMNNMNMN CM CM CM PI CM CM CM CM PI CM CM W CM 



a 

CO 

-i 
U 
tc 
00 

IS K 
0* X 



-I 

o 



I I I I I ! 1 __« I I ^i — t — I I ( — I — I — > I I 

««<t<t«<i<i<r<t<E«c«<E<t<r<i<E<t« 



<r <r <r <r 

COQO 



OOOOOOOOOOOOOOOOOOOOOOOOOOOOOO-iOOOOC^OOOOTOO-000000 
Ok O " \r> OOOOO^0>VO^-O«OO00O»ht<0BM »h n -O O 

O CM Oinpi'«rOO>OfflPIOOfOO»VOOfs(S©CMCNIO &• PJ CM 

•o «r w o» «r m in »* «■« w »r ^- to >o in rs •« »« in 




3 

at en 

X UJ 

t~ a 
<t 
n r 
is « 
ck a 

CO 

> ill 



■ 1 I 

i — i — i — 

Z Z 2 to ~1 

<t <x <r u u 

i- s- i- x x 

ooooooooooooooooooo<ruioopiooooooooooooooooooinooo'nv)oo 
© o «r o oo oooo oo*ooo-ar-iinin»oo o o ■«■ o <r t-1 ooooNoo^rm o 

mono oo on no uiPiuiinoo«ruieo»*Pi©© o ui pi pi pi pi oooopiuipii-i ■* 



CM O O CM CO 

N N H 



-on 

CM CM 



rs cm o in 
»« t* cm cm 



in in cm -o 
cm pi ro 



3 AC 
-J 3 

© z 
z « 

ce en 

3 X 

a i- 
<t 

CO UJ 

t- a 

z 

Ul 

a to 

M CO 

u <r 

u -J 

« u 

CC 

« 

_l 

3 

U 

w > 

X K 

bl 

3 



i-h oooooooooooooooooooooooooooooooooooooooooooooooooo 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



. t t I I —J 1 _J ■ I _1_!_I_I_I_I_I_IJ 



I I I I —J I » i 1 J — t — I I — I I — S I I I t I — I ! I 



u. u. 



U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.IlU.U.U.U.U.U.U.U.U.LlU^ 



x xx x x r 

3 33333 

Ul UJ UJ UJ Ul UJ 

-I -J -I -J -I -I 

o oo o o o 

0£ CC CC CC cc AC 

I- I- I- I- I- f- 

bl uj uj ul uj uj 

a. a. a. a. a. a. 



r r x 

3 3 3 
Ul Ui Ul 

I I ■ 

o o o 
cc cc cc 

»-!-!- 
Ul Ul Ui 
0. 0.0. 



XXX 

3 3 3 
Ul Ul Ul 

I J J 

o oo 
{ae.ee 



X XX X 

3 3 3 3 
Ul LULU Ul 

-I -I -I -I 
oooo 

\C CCCC iC 




o 

00 
CK 

I 

in 



CC 

o 
a. 



o a >- ui 

_l > O _J 

Ul Ul t- Z K K _l 

K Ul ►"" K l-c l-LI « K J Z CC 01 I- i-i 

« z u. zo « zee x zui 3 ui o x <r k z z> 

« jzidioo joo jo>auhH<cnoio«z 

<t >- z oujccxcc_ixzluxlux<iuicczzujxzo 

jaoh(i)iu<yH«H z«in<iciDuio<:3<cujz 

O Z *- _l CC SJ ^f-A^I-O) ZhOI-JZLI-^fl I- ,_l Z 
UI<J««3<[JUI«JJUIJOJC33Ji3:hJu1« 

zto<£wu.a««z_i«ui»<ia:<xi-uitn<i<xx<ixu 

«4««a«<i<t<t«<i<i<i<i«<i<i«<i«44««««<i«<ca«<t<i4a<[a««<i«<i<<i4 
in»<ooo«»»«oc»>mro»i*)o«(sis<ra)»<isisrt'<)inNiscMOCDPJ>opJCMinin«ouTincM»HisrjcoT-iNiso 

ocon«oi<)»MO>fHN-o*nHi<)N*i<)r)<rHiB^o.i«)ii , )oNooinM , )»'riioNffl»'fiifla)oo> 
on pi ro o cs i* ro pi t n -o ui m < n pi in in m to ** •-< o »h o oo pi ro is ro -o »-> <-i «h *-< ui -o pi -o o cm to o *o ro 

OOO0OO0OOO0O0000O000000OOO0OOO'rtO»-<©wO«-i0OrtO'rt0'^<O 

io pi o>- »-« o- pi o ui to iii ro -o pi to -o -o <o «r <r fl- »r *■ *t is pi ro *-i pi o> pi is pj o- o ©> -o is pi -o ro o o> on is pi 

OiHO0OO<-i0OO00O0000O000OOO0OO'~>O''-<O'-i0«4OOO0O0<-tOOO<-i 

^M«T«TUT in VfJUTrO-O 111 «T«yi'TUTbT«r<T<T'T^ - «rU")<rCOrS'<lfs.O|N>0|SNOIS-<JISISISCDCDCD03CD'<! 

• • • 



HI- o 

Z Z UJ HOC 

cc i-i _i >-i ui a ui ^ k fit ui 

Ul OJO Z Z Z <X UWZI-QU 

DliJiLJu.ZiC(Jl<HnjZZZZ?3OK2l0 
ox oa OUIUI_ILU OOOOOOI— m<T J 

uuu.uii.(nazi-zh(n(nti)i-fajiii^xj 

ZOJSJaZUKUJiCXfCOCZJS Ul U 
Ul >-i O-l 0<E<r303<£<£<I<I0UIU100-JUI 

3a.3a3u.-iao.acou.u.u.Z3u.xx«a: 



IllH-O 

iH — 4 © 

V V \ 

fO »H «-l 

O o o 

S. >v S. 

rs is is 

rs rs is 

<E >- X 

O 3 Z 



cc 

<c _i 

« x <r 

i- •> 

Z«hO 

<t i- ui a 

l-ZNZ 

<z <c o <t 
en co cc co 



<r <t <r <t <r 

o * o •* PI 

»* O O * i-i 

rs ih o ui >o 

o o -< o o 

Ti HI*! H H 

© ^ o o o 

Ul ^O P» IS IS 



co 

LU 



CO 
01 

<t 



>- 
a 

a 
ui 

H 

cc 
o 

01 



cc 

<t 

01 

a 
cc 
o 



-14A- 



a.Q.a.a.Q.a.a.a.a.a.Q.a.a.a.a.Q.a.a.a.a.a.a.a.a.<LGLXXxa.xxxxa.xxxxxxxxxxxxxxx 
i i i i i i i i i i i i i i i ; i i i i t i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

win^ininni/jininwn<>ininuitnioininwininww>owww 



to 

ui 
a. 

3 



<Z 
U. 



rsCMOOCMOCMCMCMONOOOOOOOCMOOOOOCMOOOOMOOOCMCMOOOOOOOOrsoOOCMOrs 
*H CN CM CM CM CM »< CN CM m CN CN -r* CN «H 

NN^f4N^NNNNMNrlNNO(^lNNN^lNNPlNN^l^N»^NNN(^ll^^^^^^^^^NN^^^l<l^l<^ 

»4 CN »* CM CN CN CN CN CN CN CN CN CN CN CN CM M CN CM CM MM.H.*»*M.rHCN »* M M »< 



-I -J 
<c <r 

O (3 



i r r I i i ■ — i — ( — i — i — ( — i — r — i i i j _j i 

<r<x<x<i<x<x>x<x<i<i<x<i<i<x<i<i<i<x<x<r 

OQOOODOOOOOOOOOOOOOO 



I I I 

<t <I <z 
a o a 



or ooooooo<oo>a<ooooooooooocN>ooooooooooijioooooooooooooocooo 

od ^•ioo»orjocM«o^rscoinoooo><rmoiiio oo-ooo ** -o 

rs k- co B onnnH'CNV'OH nnoo o>nn<o cm v m n ro 1-1 *• 

©• x »<*»< o\.-i«HroTT-OM»*r\is » »* h* 



_i ii _i it _i _i 
ce. (L en a. cc cc 
»— »— t — i — • — • — 



—i i ■ 

t- of cc 

r t- k 

-O -q- ~o -O 

o o o o r ^ ^c 



CO 



en _j 

a. k o. 

rs «■ rs 

_l jC O O _l O 



in -o •« m in 

O O O O O i£ 



I- OS 

x t- 
<o«o -o-o-o«o-o<o:>is-o s> cm <o -co in 

oor^ooooooooo^^jiiiwiiioooiioo^o 

MMSZWWMnMWnMWZZZZZZf'j'MnZr'jr'JZr*) Mrir>M3ZZ0.l-Zr'>r')MMLdr*)r*if*)r')Ldr*)Z 

uua«uuuuuuuuu<zc<i<i<i<ruuu<ruu<xucLUUUuci<x<xcMo<zuu<iursuouurs<_i<x 
xxoi-xxxxxxxxxi-Mi-i-i->i-xx£i-r£i-£CN££££aMi-M09i-r£ii.£M££££,H£K 

©WOOOOOOOOOOOOWOOOChOOOISOOOOOOOflOOOOOOOfl'OOOISOTHOMOOm 

oisoooooocmo o -o too (soooinoooo^-oocNO o oo»o©wi>*o©>o© o rs 

OHOMNnoiflH n o m <o o (M ■oononooMO in >o is in o oot*>©M.omo«o>c o co 



a>*ini*)ino3^eo^ 

•rt CM T* 



cm m w n N 

in ** » 



CNinMCOMCDCDCN'T 
CM CM 



o in m is 

O CN m 
CM 



ooooooooooooooooooooooooooooooooooooinooooooooooooo 



ooooooooooonoooooooooooooooooooooooooooooooooooooo 



Ui 

a 

M 

o 
u 
<t 

Of 



o 
3 
z 



UI 

t- 
o 



<r 
u 

o 



_l — I — i — I — I I I l ( l I — i — I — I — i — i — < — ( — i — I — I — I I i l I ( I I — i — ( — i — i — i — i — i — i — i i — J — ( i i — I I — i r i i — i 

11-lLU.Il.U-U.lLU.lJ.LLLLU.U.U.U.iJ-U.lLU.LLU.U.U.U.U.U^ 

xxxxxxxxzrzxzxxxxxxxxxxxzr co uiui 

33333333333333333333333333 xaamnencncocncncncncncncnincncnincn 

UlUlUldUllliUiUIUIUIldUIUIUIUlUiUJUIUIUIUIUJUiUiUiUi ZhhNN • . .. . .. . . . . . . . . 

I i I i I a I I l l < I I i — i I — I — 1 — 1 — I ! — t I I I ( i-iCCCtA/'. ooooooooooooooo 

oooooooooooooooooooooooooo a o • ♦ • • • •• 

ceocfiecgczcieiXQciecca^ocKCgiXiccECEiZiZiZCiiixiXircK ui-i-icocnzzzzzzzzzzzzzzz 

hhhi-l-l-l-hl-l-l-l-t-hl-ht-l-t-hh'-hhi-l- UJ Ui 1- X X ♦ • 

uiuiuiidUiuiuiuiuiUiuiujuiujuiuiuiUJUiuiUiuiuiUiuiui Kt-^uuoouitflintaiauicntncncntntnaKncn 

(Lii.Ci.Q.iiLLiJ.Lu.u.u.u.iLii.iiiiLLO.a.u.u.u.u.u.LLu. <r <i _j i-i i-i • .aaaaaaaaaaaaaaa 

UI l-MVeOZZMMMMMMMMMMMMMMM 

_l_l_l_l_l_l_l_l_l_l_l_J_l_l_l_I.J_l_l_l_J_l_J_l_l_ll- UJ id lC 333333333333333 

ihmmmmmmmmmmmmmmmmmmmmmmmmm<c UUUUUaQCGSCCSCSSCCCiQCS 
OOOOOOOOOOOOOOOOOOOOOOOOOO-I <r<I<IZZMMMMMMMMMMMMMMMMM 

-I LULU I 1 ! 1 I I I I I I — 1 — I — I — I — 1 — I — I 

ldldUJldULdlxJUILUUJLUUJUJtdUUJLdUJULdLdLiJljJLdtdldi-<'j:_l_l_l_l_) 

33333333333333333333333333WXXXXXX<t<r<X<I<t<t<t<E<I<t<E<l<t<t<£'«<t 

CfCKOCKItaiCiiCtCuIilitiiitaiCiCiCilliiiOCitHi-l-h-l-l-HjjjjjjjJjjjJJJJJJ 

uuuuuuuuuuuuuuuuuuuuuuuuuuauuuiiiiiiiiiiLiLii.iLiLU.ii.ii.ii.ii.ii.ii.ii.ii.ii.ii.ii. 

na>MTMCDMrsTuT>oiiTrt^K)^«nrgin^'rt'-irx-ocoT»r'rHnNrs>ocK-ooooiS'-i~ocDr>iTCDM'rtoa(a'T 
oo^OMnM©ocNCN.-iMw©MMM,-icNt*)MM©CNOM©©©ooMCNCN«-i-Mt*jcNCNM©©«-iMriMCM©© 

S.S.S.S.VNN.S.NS.XS'SS.NS.S.SSS.SVSXVXS.SSVS.S.S.S.S.S.S.V^S.VS.S.VXS.SS.VX 

CM O 0- CM CM CM O »T CM 111 CN CM CM IS CO W CO 00 M O- Irt »1 CO m O CM IS O CM CD CM M CM CD O T V W -O -O CM CM CM »• CM CO m <T -C O- 
T H^iOTHOOOOOO^^OOOOOOOOO-<Or-rt'-<0-rH'-iOOO-"0'-<000000000-HO-'000 
s.vs.s.s.s.s.s.SXNS.ss.SVSS.NS'ss.s.s.s.vs.s.vs.s.s^n.ss.s.s.s.Vs.s.vvs.s.s.s.ss.s. 

«'OT - 'Oisin-o>ofs>o>o-ocDis<or^(siscocDrsisisisa)a»MMCDr)co*>0'0-oinini*)iniiTiniiT-oroT , MiiT>ouT«r 
r>.rsfsisisisistsNrsisisisisistsrsrsisisisNrsisfsisisisisrsisisrsrsisisisNrsrsrsisisfsisfspvis(sis 

>>«>>Xt>OQa^l-«lll>-)'>-5>-Ot->i|-X2Z4J«^<IOZB«««XZIZtJ>«I«Mt 
33U3i^K0.3ZZZO3LLK:Jt33Z3Z333l-t-h-a.«3iOUt<tcnUUu.l-l-ZI-_IU,i£_IOUZO 



CO 

* > UI >- 

os a ui i — i— i— 

U O _l w (- M 
O _l U 3 U 

o 3 _i <-> ii a ui 

a. ce _j ■> ua aaz 
cnui<zcnocis>-Lizin 

zoiQiZotn o<ili 



« Z OS OS 

hOUUI 

_i i- a: ae 

O Z UJ UJ 



o 

CD 
0- 
m 
I 

m 



l_l r- XUJUt^UUJUULJ U ^ UJ UJ 

w ju>un-ci:zzu.uiu.jiuiii:acc 
" jNaeec^ouHO-icuzhctz)- 

MO<icuiiiioj<iu:€<t3<Hii6yyj 



CO 

o 

z 

M 

cca 

u. -I 

in ui 

■ji u. 

U _l 
O UI 

os a 



Id Z 

z c 

en z _j 

U3h 

X o m 

U M 3 

3 a. Ci 

a 3 



CO 

o 

z 

■- a 
x -I 

LL. UI 

cn >i 

u. 

a z 



a 3 

O Z UI 

O 3 >H 

3 O > 

iC h- UJ 

ui cn u 



CO 
UI 

_l 

> UI 

OC o 
Z ui Z 

Mu<iii: 
j« <r 
a -J tn £ 
3 3 O <C 

a r _i _i 



o t-><E « 
O U S £ 

U. MM 

a _i o o 

_l _l u o 

o m <r <t 

U X lL ll. 



X UI O UI 

cn _i m 3 

z_i i- o 

3m <t ce 

OJKllI 

h tn cn 3 z 

z cu 

_i 3 z 3 a 

_l o <l a 3 

UI lC UI _l o 

a a a <t _i 



Ui v 

co _i m ui 

Z >" -I M _| 

« I- M U _J 

UI M 3 M M 

JU JIZDZ 

CC —I UJ UJ o 

O M UI M _i £ 

z cn cn u 3 

3 <t(Jl 01 Li € 

UI _l 3 O m ui 

z a. i£ a u a 



U Li 

O UJ 

_l o 

z 

UJ M 

^ !£. 

a u. 
cn 




o 
u 



z 
<I 

cn 
cn 



>- 
a 



-145- 



01 


LU 

a 


xiii ix xxx ixx xzx xxx xxx x a.a.a.tt.fi. c o. a. o. a. lllzxzzzii xxx xii xi 




Trt 


o 


r r~ i _ r 


1 — I — 1 — t — t — t — 1 — 1 — 1 — I — 1 — i — 1 — ■ — 1 — I — t — 1 — 1 — 1— 1— f— 1 1 — t — ■ — t— 1 — 1 — 1 — 1 — I — 1 — t 1 


1 1 1 


1 1 1 


1 


1 1 


i 


1 






0£ 

(0 

ID 




X-X.XX.Xm. III. X X I IXXXHXX.XX.X.X.X.X.X.X X.X.I.X I I 


III 
w ss in 
o o o 


XXX 

in in u3 
o o o 


I 
LO 
© 


X X 

s: in 
o o 


X 

n 

o 


X 

in' 

o 




UI 

a 
« 
a. 


iv>inins3ins3in.iniaifl«rinininLacMininin-iniaininin-* m m in. in. in in. m in ss mm in w in 






rs©©©0©©CMOQO©Oa©QCMQCMQQQ©rsOISOOCMOCM©OOCMOOOO 






or 

3 


»± 


-■_f>J -_----- CV - Pi - - - «* •«--CM-N--CM-- 




















CM CM CM CN 


CN CM CM CM 01 CN N IN CN CN (N CM CN CM rt W CM CM CM N r% 04 C4 N CM CN CM C J CM (M CM f-J f) CN M 


CM CM CM 


CM CM CM 


CM 


a cm 


N 


CM 








CM. CM 


CM CM CM W CM CM TJ CM CM CM CM- CM»*CMCMCMCM ■ «H _ CM •< CM - CM CM CM- ■ CM W CM CM 


CM CM CM 


CM CM CM 


CM 


CM CM 


CM 


CM 






a 


_l _l 


i i t i i i i i i r ( j i i i ■ t i i _i i i ■ i i i ^-i i — t — i — i 


1 I I 


_J _l _J 


_l 


-1 -1 


_J 


-1 






or 


~« «-<x<E«<r« <r «■«■« <t <t- <t <x- « <t <£-<£■« <i - - - <t <r <z « <x « <x-«x <t <x <t <x 


<i <r <r 


<z <t <z 


<I 


<E <t 


<Z 


<I 






-i 

OC 


"O(3C3(3OOOO0OOt2iDOCQ0L30O0 CD ldlDCOOOCD'OCDCDCDCD 


coa 


O C3 CD 


o 


c o 


LD 


CD 






oomo 


LQooooooaoooQQooQinooopooooooocoooo<rL-3 


© © S3 


o © © 


© 


© o 


© 


ill 




CO 


- 


-NOB 


©ooaooooriO-CMOQo-o ©ou- "o -cnoocsoooooo 


© © CD 


©CO 


o 


1 © 


© 


«*- 




N 


te 


iH 


-LOIOOOO<!Wl]TCM.CS--rs© r rr.CM©- -CM -©-oo-oisnococ-j 


© CD CM 


ss cm m 


^-< 


*3 CD 


03 


CM 




0> 


Z 


<■ 


.lN^lOIQ.-OTW0D;-T_r>2_:TH^. > .- : _S3l«2- lO W ~ CM - <0' >0 ri W Ul 


in co 


^ rt CN 


CD 


> 


T 


iH 




UI 


z 


-J 
-z: 


_l _J 1 1 1 I i I I I _1 -I -I -I 

croc ocki— -j- ce.cc ofcccc ccoc ►-- fl£- 

l-h- HZZ--H— t-l- h-h-l- t-l--_Z t»- 


-1 

OS 

1- 


-1 

G£ 

1- 












a 


•i 


ssnrsr 


-<o - - n m in. ~<rr"UT-cr r«:.rs<r- ^- -o ^-e---o_-eis 


S3 S3 


S3 S3 


C-i 


S3 m 


S3 


S3 




o 


It: 


o ©©z 


-Oj:2ooozeso ©o© :o<5^^2iii£ii: cs^jcooso^oo 


i£ © © 


© O ^ 


© 


© © 


© 


© 




a 


Z 


M»l«3:CI02Z«l!II2D=^2t*fiiiU!flMZZ«?2ZWW22r)f03r)2n« 


2MO 


P3 ?n 2 


1*3 


n m 


1*3 


.-■3 




a 


O 


uuaie 


^UC<IUUU<ICc:ia'-i:<I:UtCi-Cl:iSUO<E<r_l<E<X«ISQC'CU!J-Lt:CJ-«UU 


<t u o 


cj cj <r 


^ 


u u 


CJ 


CJ 




3 


a 


xfsSfair'jxi-si-szz^aaxcjxxziazzt-tai-^i^wSKKxxaxH-xx 


H- 2 E 


Z 33 r- 


Z 


2 2 


2 


2 




CO 


o ©■©■ o 


LOOOOOCQQQO© ©QQ©QCO©©Q©©0©0©»-©0©©0©© 


© © m 


© © © 


© 


IS © 


© 


O 




x 


LU 


© OO - 


MOOO©0©0 -O© :©©© ; - © - -••* -©©©©CM©©©© ©N 


© <T 


CO © o 


© 


M © 


© 


© 




i= 


a 


K3 B_ w -"- 


■ O O O rt f) O O .©© OO©; ©..; ;.-. BI^O. © © © © 00 O LOth 


«T -« 


S3 S3 CD 


© 


© n 


«* 


© 






* 


ft » - 


















w 


z 


Pi— j 


CO O O M Mil ID CMN U3W-H © S3 OCM»-cinil"3^SD f*3 

•Hrr3rs~»s .- - _cm - - cm — f -■ ^<f -in 


<r 


ts S3 


© 


n 


PI 


O 




Fs 
0> 

> 


a 

03 

Ld 






M 


rs 






T-t 




-I 

3 

a 

z 
)=• 

X. 

3 
B 

03 
fc- 
Z 
& 

I 

u 

a 
5 


M 

•=3 
Z 
w 

09 

X 
tr 
<t 
Ui 

a 

(0 

03 

« 

a 


© O© w 


OwO©00©000>4©©©000©©©©©©©©©©0000©000 


© o o 


O O © 


© 


© © 


© 


© 




© eo © 


©©©©©©©©©©©©©©OOOOOpOpOOOOOOO-iOOCO© 


© © © 


© o © 


o © o 


© 


o 




JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ 


i i i i —j f 


-1 


_i _i 


-J 


-1 










UlU.Lv.Li. 


LL.LuU:U.U.U.U:LuLCU.LuLLLul^LLLuLCLi:U.U.U^LLLL;LLU.U.U:LuLk.LuLuU.Lk.LL.U. 


U. Li. U. 
2 2 2 


u. u. u. 

2 22 


2 


u. u. u. 

2 2 2 


Li. 
Z 




et 


-»_.....» 






? 




OB SB 0k 03 


osoafflcocooaiBcBaaeffiiflfflssfflieie^Stnannin^ifl^oi^iDfflaffi 


a a a 


a a a 


a 


a a 


a 


a 




3 








sc cccz 


2^2 


cs 


cc uc 


ar. 


cc 




s 




b oo a 


osoooooc3cssai3eeeeesseG3eocaoaocao3333 


3 33 


3 3 3 


3 


3 3 


3 


3 




o 




3 7X7 


333^»t»^3^t»7-^^?^^T» — — — — — — • • • •-*-•-• • .|ifc-f-l- 


I- 1- i— 


1- >- 1- 


h- 


h- 1- 


I- 






z 
m 


3£ 


z zz z 


ZZZZZZZ222Z2ZZZ2ZZZZZZ2Z2ZZZ222 


2 2 2 

O G 3 


2 22 

o o o 












g 

D 
Z 


&in&&<3l!ft&a>&(fttTi&ai&<nuimc)irimvimvimmmvitnviVim»itiviinaociCi 


2 «. a. <- ^ 

o a o a c 




-> 


aaaa 
















03 
UI 


(0 


3333 


333333333333333~33333333333S333«««t<t 


« <r •€ 


<t <r <i 


<t 


<s <c 


<r 


<C 


z 


Z 


OBSBOOSoeseBse388ess9aaBaBOBOsoBO£50wwHH 


1— 4 >— 1 1— * 


n n t-s 


HH 


t— t J-S 


*— * 


>H 


a 


& 


s 


HUWU 


Wbdteitadfc5ifcrife=ffc=)t=t'crfi^'9l999^P^^'^»^'' : ^P^H*-(^(HHh«ni-lia55-^5' 


^ © 3> 


3> © 3> 


© 


© © 


© 


© 


o 


o 


o 


33JJ 


jajaanajidJJJidiJd=jiiddJJjJjJjd««'5:'l 


«z <r <r 


<I «<t 


<x 


<I « 


<r 


<r 


CJ 




x zx z 


SrSXXZ222=Z2ES£ZZ£SEEZSZS:ZSS:tEZ_l_'_l_l 


i t i 


_l _l _l 


_l 


-1 -1 


-j 


-i 


>- 


©■ 




«c «« « 


i4iec!ies£ccc£a«i:4£4«4s<:s$jj<;'i45aauiij 


LU Ul UJ 


LU UI UJ 


LU 


UJ LU 


Ui 


UI 


l- 


z 




3 3 J J 


3JiaaadiiJJajddi- , 3=Ja5lJj=i'ddd«dJiS333 


3 3 3 


3 3 3 


3 


3 3 


13 


3 


n 


& 




BCKCCEC 


!ElLfttLtLlLbi&tklEbi£lEb:bci£telt.klt.h.S;ILILIL!ZILiLlbWklkL.Lv 


U. U.U. 

T © M 


u. u. u. 
S3 in CM 


U. 

CO 


U. U. 

cd m 


U. 


Li. 
CM 


a 
o 
z 


ta 


sr «*ia * 


P3*corid3-o©-r<rsin^oo-och&-a3fl - eDCsisir)^ri-oa3s3«»<o303isuTT-i 


fc- 




OOCJ- 


OftrtOaxBOOHCinO'iHNOSs^OHRfiBNh^rtOw-OOO 
^S.^VS.XS.^^'vV.K'v^'SSS.-v'SXS.^^.S^V.VS.V.XSS.^'vS.X 


© ^ O 


CM CM O 


© 


■-H f -J 


PI 


O 


z 


z 


ui 


XS.S % 


V s. V 


s. vs> 


s 


V V 


s* 


\ 


o 


a 


e- 


>o ** »< o» 


Ms3rij^i^^j-ir^N©csOr!i E iorva3~o--H-orii^ri-ico ; o^-icN-i ; <3©ncDis 


•1 CD CM 


i-c n r-j 


^< 


CM S3 


<0 


o 


CJ 


a 


<x 


9 SO © 


OOrtOOw-OOfOTiOjiaoOOSOCiO^iiO^C'Orf- Oft**©© 
VS.'VVVVS.S.S.N.S.N.S.S.VV.S.^.V.-^-V'N.v.T.^iVS.V.'^'v'KSi^S.N, 


O O O 


© o © 


T* 


o o 


© 


11 




tn 


a 


S>VS -s 


\ S. V. 


s. -v s 


V 


s \ 


X 


s. 


a 


u 


~~ 


♦* voo rs 


mNrscooD«oN<csrsmmiscommcoo3is«rjnfl - s3inoarviso3rsrvisrs<iivs3 
isrsNNfsNNNNNrvrsisrvr«.NrNrsrsNrsrsTs7s.sisfsvrssrvrsfvis!v 


rs s: co 


CO CO S3 


N 


is CO 


CD 


CO 


z 


z 




IS rsN IS 


is rs rs 


is rs is 


rs 


is rs 


N 


IS 


<x 


z 


« <Z-j <r 


330ZOH34D^J02lieatD£<3l-£Zyi.t'Zi<;Sli««W0 


<t z <x 


o o *: 


a 


z a 


a <l 


to 




o 


?u«? 


O Z O 


u u « 


CJ 


ZCJ3 


03 


CJ 


CO 




fc- 




> Z 03 




00 








00 


-1 

CJ 




a 


a 


fc-" . H- hi I- 
- Ill Q— IH _|-I LU_I 00 




o 








UJ 






o 


z 




0. 








-1 


3- 




-.i 


UJ 


r _i - ITn" u « ^ ^qz l- a _i > uj 


O 03 


03 






> 


UI 


a 




- 


CO 


i_i- uj en icmo. z. za<r<tt- _i 


0£ Ui 


K 




V 


1- 


o 






t- 


z z 


fc.il- &J_I3 « 1 X " . « UJ K Zw OCCZIOIMI LU 


o u 


O 2 CJ 




i- 


f— i 


z 


a 




z 


3 O O 


M3-. - 2_ilu iao3 2 u- uazin ' oo ~ (-«03-cuuo_io 


a 3 <x 


a a ~i 


a 


>— i 


u 


<I 


UI 




UJ 


O ZZ h- 


Z2<t. OMl-ijiaZE O M — +- . UJ03+-U. 03JJ3C3U 21- w J2 


CO CH 1- 


<L H 


2 


CJ 






i— 




a 


1- ii O I 


oozu(-<t3~;outi:i->-ci: o: o « j <i in - v<H«ziuiiij <& uc u<i 


2 CJ 03 


oc x <r 


<r 


o 


a 


en 


{£. 




H 


a i- a 


xnoumaiojeEMUitKiuuiQjoajoiuojMhjcnHhN 


i-i 3 


OCh 


^ 


a _i 


w 


o 


a 




u 


^- a Z m 


attrj>-azojiai2*oii.iL2j«^«a , <iajx;iB-i.uj« 


<l en o 


_l w _l 


^ 


Z -1 


0. 


-1 


03 




z 


BUBE 

Lena 


«hO3U4lD0«J4H- OS-«iiJ CiE-«- « if3 <ryjO«MK<H40 


3 « 3 


o ce ui 


<t 


O i-i 


•X 






o 

CO 

o 


J5< 


atne.ei£3>aihOi«9i3Nezj£ii.ti«iiz«-<aad cxznftfifij 


00 _1« 


u a a 


o 


x x ce 3 


LU 
Of 

1 


o 


<c«x««x 


«<i<i«<x«a<i<t<t«a<i<r<t<t<i:<i«a<i<E«<t<r<t<r<t«<i<t«<i«« 


<z « <t 


<z « <r 


« 


<x <z 


<Z 


<x 


T* 


z 


GO O *T N 


©coriNa3s3r , 3C v icsr3M0 , -CD-OL'Tti3s3fl-rj<r'<rMrsiN.isi<)<Ti>wiso3«H^-r3 


S3 -ph S3 


m fj n 


CS 


CM ro 


«r 


CO 




1 




f*3 r*3 CN CD 


O ,s r4 ,h ^- n M S3 111 'JT -0 OS CM LO tH ^ M © Kl © rt r-J n -0 CD O CD © ^ -s IjT IjT w «r C-l 


<T llT CM 


<T CD in 


CM 


in is 


IS 


1*3 


03 


in 


t- 


■flNM*) 


ors>'Tfl-rsorsc'4-jisiiiTsq-s3isoris:-s:-<n^o^MrjijTfl-o>-<rocofs<T 


U3 CD n 


in c-i m 


wi 


CM liT 


LT 


in 


a 


.*-■ 


as 


OOOO 


^©000©rHOi'i©©©-rtO-rtO-rtOO©©©0'r-iooooOrtOO©© 


© O O 


© © o 


•H 


© © 


© 


*-i 


l£ 


i 


a 


is v n o pi iv ? i w r -j « cm o- is :o 03 r* pi i f -j co o> ^o ih ts «r -*r *i <m co is m w -« *-< «o ^ cm cd is 


in 03 CI 


r j in o^ 


1-4 


n is 


N 


o 


o 


z 


a. 


O OO jh 


©0©0©i-<>-<0©w©TH©T"<i-iOO©©-©-©©0-rt©0©0-©T*©*-iiO© 


o © © 


© © © 


vH 


© o 


© 


11 


u 


« 


u 


V «T CO N XB IS CD 0303 NJJs^OJSJSfflinjSinBSnJffl.XOfs-'Tjn-^'Isjri-CDPs^ COCO N fs fs S3 IV S3 


IS S3 CD 


03 CO S3 


IS 


IS CO 


CD 


o 


UI 


^■j 


ft 




— — — w- s, -x. .. . 












• 


OC 






-W6- 



Ul 

a 
a 

s 



XXXOlCLCLXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 
I I I I I I I ! I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



CMOOOOOOOOrsOOOOOOOOOOrsOOOrsOOOOISCMOOOOCNfsOOOOOOOOOOOOIs 

N *i *< - ** «* cm cm r-< »h 

CMCNfNCNr-»r"lr4r"4 r* r-l rH r* tH vl rH r-l C J *H *H r-l r* CN rtrtrtrt r-l r-l r4 r-4 rt Hrt H*< rt 





Q 


JJJJJ 




-1 


-1 -i 






-1 






















tn 


<i <t <t <t <i 




« 


<E <L 






<x 






















-i 

Ul 

ce 


CO O CO CD CS 







O O 





























inrowisriooooooooooooooooooooooooocNoooopoooooooooooo© 


O O 




00 




T CN r* CN O 







O T 






* 




















rs 


i- 


CN <• CM O CJ 




<o 


O «0 






MJ 




















r4 


r 
<r 


rH W 00 CN 




CM 


* »H 






r-l 




















Of 
Ul 


Of 


_J )£. -1 _l 


-i 


-l-l -1 -I 


JiiJ 


-j 












-1 












a 


z 


a o: ce oe 


oe 


os oe oe oe 


oe oe oe 


oe 












oe 












r 


1-4 


h- h- 1- H- 


K- 


i- 1- t- i- 


1 — t— 1— 


i- 












H- 












Ul 


« 


O < m -0 CM 


-0 in 


W si UT >0 -0 -0 iTJ «o -0 -0 


•0 


•0 


CM 


CM CM 'O »o in 


•0 


~0 CM 


CM 


>0 


-0 





-0 


in 




CJ 


1- 


SCieO^OiOO©© 


*: 


i;^:oooo.i£OOOi£oooo 


£..£.■*.■> 


■*. 





00000 








O 


-Ji. 
















Ul 


z 


zzMznznnn 


z ro ro 


zzMnnnzMwrozronmn 


z z z ro 


z ro 


M 


nnnnn 


n 


n ri 


M 


ro z 


ro 


n 


ro 


Ul ro 




Q 


o 


<«U«U<[L'UU 


•a cj u 


4<[UUUU«UUU«UUU!J 


<r <r <r 


<L O 


CJ 


CJ CJ CJ CJ CJ 


CJ 


u 


u 


u <r 


CJ 


Cj 


CJ 


is u 




3 
0£ 


u 


HI-XI-XI-XXX 


i- z x 


i-Kxxrzi-zxxi-xxxE 


i- 1- t- Z 


1- X 


x 


X X X X X 


X 


X X 


E 


x 1- 


X 


X 


X 


IH X 




CO 


©oo-oooooo© 


cm 


oooisominocsoooooo 


0000 


<r 


■0 


00000 








M 


CN CM 





O 


CO 


O O 




X 


Ul 


OOrsO©©*Crs 


cs 


00 •o<r<rooo'roomooo 


OOO 


rs 


*o 


00 00 







O 


•0 ts 


c 


c 


3 


O O 




H- 


o 


OIOHO|ft«*N 


O 111 O 


woo rt<ro^rso<ooo>o^oui 


in 





-" 


MO OO 








rs 


th 


c 








rs 

IN 


O O 

111 <T 




M 


IO PI CM 111 IS M CM 


CN IO -0 


cm n n hii)hc(>nhoiii 


m 03 


o- 


>T 


HO TO 




IS 


<X 


CM CM M 


«-l 


-H CM r* CM 


*4 






»H CM T 




M 






ro 







ro ^ 




0> 

r* 
> 


a 
tn 

Ul 






^-1 




















T-l 








-1 

-) 

CD 

Z 

M 

oe 

a 

(0 

z 

Ul 

a 

M 

o 
u 

« 


oe 

-) 
Z 
i-i 

CO 

P 

<r 

Ul 

a 

U) 

CO 

<c 

CJ 


ooooooooo 


OOO 


OOCMOOOO^OOOOOOO 


OOOO 








OOOOOO 


O O 





O O 


O 


O O 


O 




ooocooooo 


OOO 


OOOOOOOOOOOOOOO 


OOOO 








OOOOOO 


O O 


0000 


O 


tH 







JJJJJJ JJJ 


_J _l _l 


1 1 1 1 1 1 1 1 c t i r 1 1 1 1 1 1 1 


-i -1 


-I 


1 1 1 1 I 1 


-1 -J 


_i 


-1 -1 


-J 


-1 


-1 


-l -1 




U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.II.U.IJ.U.L1.U.U.U.U.U.U.U.U. 


U. 


u. u. 


u. u. 




fie 




z z z z z» 
































« 




a a a a a oe 
































_i 




oe ce oe fie oe « 
































3 




3 3 3 3 3 CJ 
































(J 




H t- h- h- 1- O 
































l-t 


>- 


00 
































X 


1- 


z z z z z a 
































Ul 


w 


o> 
































> 


a 
o 


HHMHHl 

ht-l-hh 






























to 


a 


X 


« « <C « <c to 






























Ul 


z 


X 


HHHMMiUILiUI 


Ul Ul Ul 


UlUIUIUIUIUIUIUIUIUiUIUIUIUIUi 


Ul Ul Ul Ul 


Ul Ul 


Ul Ul Ul Ul Ui 


Ul Ul 


Ul 


ui ui 


UJ 


Ul Ul 


Ul Ul 


a 


3- 
-1 


o 
u 


33333MZZZ 


z z z 


zzzzzzzzzzzzzzz 


z z z z 


z z 


z z z z z z 


z 


z z 


z 


z z 


Z 


z z 


z z 



u 


BJJJ 


_l _l -I 


1 1 1 : 1 t 1 1 1 i i 1 1 1 1 


I i I ( 


-I _i 


-J 


1 t i i 1 


-I 


-I -I 


_J 


_! _J 


_1 


-1 


; 


_J _i 


a 




1 f I 1 1 OOO 


OOO 


OOOOOOOOOOOOOOO 


OOOO 








OOOOOO 








O O 


O 





O 





> 


3 




uiuiuiuiuicotocntn 


CO to CO 


cn cn co v. cn cn cn tn tn -i cn cn cn cn cn 


cn cn to co 


cn cn 


LO 


tn cn cn cn cn 


cn 


to cn 


cn 


cn tn 


CO 


01 


CO 


co cn 


r- 


z 




33333«<t<t<I 


<I <Z <L 


<E<r<t<r<t<r<i<E<r<r<E<t<x<c<t 


<t <r <t <z 


<E <t 


« 


<r <r <r <t <z 


<t 


<E <L 


<r 


<t <t 


<L 


<: 


<r 


<z <: 


»-l 


w 




U.U.U.U.U.COOOO 


OOO 


OOOOOOOOOOOOOOO 


OOOO 


O O 





0000c 


O 


O O 








CJ 











a 


X 


co 




CN«NCN«r-«lseD»r© 


«r ut 0* 


oifliftNHO»nriri-onv-or) 


r«i w m 


CM O 


T 


in cm «r «r in 


in 


•^ O f 


f 


o> 


CM 


^^ 


ro cm 


►- 




OOONNNrt^n 


CM -i CM 


M f 1 rt O *l M H rt O •< rt rl M r< rt 


CM O f-4 -^c 


n 


CM 


CM i-i CN r i 


i-t 


tH O 


-rH 


CI ct 


CM 


i-t 


i-i 


CN r-l 


X 


z 


Ul 


XS.N.VS.S.SNS 


S, S S 


•SS.VS.SS^S.S.SVXS.S.VV 


\ s s s 


V s. 


s. 


\ S ^ \ -s 


s, 


S. N. 


V 


s s 


•v 


\ 


s. 


S s» 





Ul 


t- 


o-ocNCMrocNror<rs 


•rt r* rO 


r)Csr*)<ret*i'riCD^-«T<rcM«T , tvcM 


t ri n 


llT CN 


T 


-0 ro >o <r 


<T 


llT Ul 


1-4 


m lt 


in 


C-i 


-^ 


UT -1 


CJ 


Q 


<c 


r<©i-(r-l©0©©© 


c 


OOOOOOOOOOOthOOt* 


c ^ 


O O 





O h 


O 


O O 


O 








r-i 


c 


O O 




►H 


a 


VVV.\NNX-vN 


\\\ 


S's'ss v SS,\SX\\s > v,s.s. 


s s s s 


s s 


V 


s s s. \ \ 


s» 


S. S 


s 


V \ 


s. 


s. 


s. 


s s 


a 


U 




CDOOCOTCOIOTTrO 


<r <r <r 


<rififl""rtD«r<TMfl->o<rf<)<Tij")if) 


<»■ in >o 


^- UT 


1 


iit -o tn in -r 


in 


<T T 


«r 


T T 


<5" 


in 


«r 


T <T 


z 


z 




rsrsrsrsisrsisisrs 


IS rs rs 


isrsisrsrsisisrsisrvisisisrsrs 


is rs is rs 


rs is 


rs 


is is rs rs is 


r\ 


IS IS 


rs 


rs rs 


rs 


rs 


IS 


IS IS 


<r 




z 


«zoecorMXtnxz>z<i 


_jzrzxxx_izt-cn<roz« 


ui z <t 


M <t 


IK«>H<[ 


>- 


z ■> 


\~ 


_i <t 


<i 


<c 


N 


■*£. <X 


to 




o 

IH 


O H« 5(£ «z r OW 


Z l-l M 


<£XZi-iZOZU.t-i3je:^ut-3XI-Z3 


X Ol 


OJ3^3h 


A 


1- 3 X 


u. r> 


;> 


Ql 


<C 


O M 


cn 




r- 






to 


























_i 
u 




CJ 






a 














cc 
















o 


CO * 




Z <E 






Ul 








Ul 












V 




-1 


ui cj oe oe 


a 


x to ui ^e oe 


z 




-I 






Ul Z 


l-l 












a 






_| ui 


-J 


<t Ul OUI-IUI0.O 


3 >- 


oe 


_l 






_J O CJ 

















1- 


ui ui oe 3 a oe 


Ul 


xx ui a.uiui_i uicno 


1- 


Ul 


l-t 


z ui a 




_i r- 


<x 


a 




Ul 


Ul 




a 




z 


Oh m X <I O 


M 


o_i t-_i cntuH ce z 


1- M O 


CJ 1- 


r> 


1- M 


Q 


■h cn 


-I 


te z 


_i 


z 


CJ 




Ul 




Ul 


ZNiuice<-iz a ui 


cn u. i- 


zo o_i ii-> o<x<ir 


CO) Jffi 


<L CO 


z 


z a _i z 


Z 


^ Ul 





<z 


<r 


cn 


a 


a 


H 




a 


<I 2 _J 2 00 <r CO _l 


ui z cc 


^-Xtnouj iMQin cnhM 


<r m cn 


Z UJ 





ui .0 ie ui 3 


<r 


Z _l 




_l X 


oe 


iij 


i-i 


X lC 


oe 




M 


Ulh-_IUIUI_l_liO 


_J M <t 


r(fliO3CI)uJ0)OZDIOI-D 


x ce _. _i 


<Z X 


oe 


ce _ z ce z 


_i 


lu oe 


H 


X 


UJ 


~~r 


_i 


O M 







CJ 


co set- -i a a a _i oe 


0. <t 


iHaoaii/)jjU)ozccue<ta 


ce.ce ■> 3 


ce u 


« 


cc r <i uj 


X 


Ul c 


cn 


>■ u 


Z 


n 


a 


iL <t 


tn 




z 


ou>-t«iocni-i<r 


<r -J t- 


MXOOOOXw<t<ruii-c<IXLU 


O O <L O 


<i 


nr 


3CCCJJ 


CO 


l£ X 


<l 


Ul >-l 


t— t 


3 


O 


r— a 




o 

03 
0> 


M 


-1 z _i u. 0. w x x 


Zu.ii) 


OUI JiCiCXV jT iiiuol 


OlUi 


tn oe 


CO 


a. u. u. 


<c 


u 


Ul 


jl oe 


X 


a 


CJ 


tn <x 


Ul 

oe 


o 


<x«<t«<t<x<r<r<i 


<o <r <t 


<c<r<r<r<t<i<r<r<Ea<t<i>i<r<r 


<t •«'•« a 


« <r 


« 


<t <z <t <r <r 


<r 


<t <r 


<r 


<t <r 


<t 


<t 


<t 


« <t 


r* 


z 


oo is cm o> iv co cm 


-0 IS tH 


N03TllTrt<t^OnO>OM>'0-CCI 


111 -0 O-N 


iii 


■0 


<r rs >0 On ts 


> 


ts <r 


CD 


»-l T 


rs 


IS 


"■v 


c 




1 




omcoo oin<rHN 


t4 CS -0 


rso:ommcM>oors,H«Ttf)*oMo 


<r 00 3 


tH O 


m 


<ico cn <ro> 


CM 


O r* 


O 


n «r 


n 


CM 





th rs 


in 


IT) 


r- 


-o>oN-oo»H<roo 


«T M r-l 


th ui c-i n «r n m in m >o in w \n n rs 


<T cm r-j 


W vO 


*H 


n n >o in 


rs 


•O O 


n 


•0 -0 





<0 


•*2 


f J CM 


Q 


«4 


« 


ooooooooo 


OOO 


OOOOOOOOOOOOOOO 


~ 





O 


c 





O O 


O 








O 


c 


c 


oe 


1 


a 


-o cm <r w m cm cs 


^ rt «r 


tOTT0>THS^Ttrt»ON 


iiT ri <r 


liT O 


LT 


rs <T >, LT 


*r 


LT llT 


<-4 


in m 





r-j 


— ( 


O r-l 





z 


a. 


ihO'HOO^hOOO 


OOO 


0"OOOOOOOOOOO^tH 


^ 


O ^ 


O 


O O O tH O 





O O 


O 


000 


T-l 





O O 


CJ 


<E 


Ul 


a>a>aoisa>w«r«rio 


*■ v <r 


^■iiTfl"«ruT^ , '<rr)<r<ofl - fl-<riiTiiT 


t -o in >o 


<r ill 


<T 


lt «o iii in «r 


in 


<T «T 


•» 


»r <r 


<r 


111 


<r 


T T 


Ul 


-J 


fit 


• 






























oe 



-147- 



33 

m 



m 



m 
a 



eg 



3> 

en 
en 

3> 

2 



m 
en 



*W*J>lU'ICI'*OI4>lU1M1iJ>J»AUUH.Ui|J>J>*l).*J>*LUilOI***LUi|*lUi|AJ>Ji*(.ilJ.*4>** 
Oi-'OOt-'OOOOOO^OOOOOOi-'OOi-'OOOOOOOi-'OOOOOi-'OOOt-'OOOOOOOOOO 

-o ro >- w ro cs r o •« tn ■« cs M h» o> as cd ►* co ro o> a> r j sj i- si ^ u si si r o o» ti si si si ro o- si a> i o o- &■ »-> o- co ►-> o> o-- o> o- 

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOi-'OOOOOOOOOOOOO 
*UOlilUM*HOOMA»'^U!.lH'W*(l)'0*fflHBHW|MK»OOlllmjlUOU l 'UIMJIIJtllHM»*UU 
O~rjrjWtnj>^<Utni^J>Ch*©r0CDtn*©^Wtni-0»slUtJs3C0slC*A©s3>->-Ch>0tnsil»li->0AChroC0r0 
O H W M A -O H M « I J < O H O M A M i o- io tn y ». in IJ -O M O- U K \| -0 I J CI O O CO u tn M U (J M W k O CK -0 CD u 
3>3>!>3>3>X>3>3>3>3>W3>I>3>3>I>:>3>3>3>3>3>3>X>3>3>3>2>3>3>3>3>3>3>»>I>3>3>3>I>3>3>I>3>3>»3>:r>3> 



C 1> 

3? Z 



z 



ewe 

m r 
o c -n 
-i m o 

o 33 

3? w ^ 

10 

r 
» 
z 
B 



ZEE 

3> "I 3> 

c I - -I 

3> r~ m 

c_ >-i 33 

o w r 

o n 

z * 



w I 

Z M 

c z 

O W 
O (TI 
53 C 



Z tO H 

•c m r- 

3> <= rn 

c_ m c 

o z o 

CO 

•v 
» 
tn 
to 



-two 

33 33 33 

-< i> m 

O M 10 

Z O -I 

CO o 

z 

t_ 
n 

-» 



a>ZEcnociw3>c_nwna>nTjr?;o3Cic 
hcj jMnjccur jr»Mrrin»» 
xzcn^^zzowzi-iTii-ii-rTiTJWTJinz?? 
RTJiOTizom-innozmc^rnzo-iTj 
zoMXMinmiM-ozHfflnaj) nom 
9)m2HRHjco2Hoc)o r o 3> n 3> e z 
ozthwh oo z >cro r 
-< z b o o z zzem 

o m z e o-izto 

z z n 



3} 



-" CO 

33 TI 

m 3? 

CO >-i 

-i z 

a en 

z -n 

to il 

w m 

c r 

33 b 
a 



T) T| H 

M 33 3> 

n « z 

r. en "0 

m o 3> 

-i O 



h 33 z -n 
n o cr 

iiido 
c c ■*. e 
r- r m m 

3> C C3 X' 

tn o ■< 

z 

B 
33 



I - ZI -< 
M M 3> J> 
W 033 N 
m 3? 33 O 
33 mw O 

3> r to 

roi»n 

CC ii 

H33H 

r o -< 

r 
m 



©■nZi-ii-i3>CCZ3>3>COZ 

?;r-<rzrsi-t3>-<33N3>xn 



EOZTiwCZZfZ;*Mj>ZXOn 



I -< i c_ 3> r 3> -i 



2Ti^Mjuon^no(i)07ictniiio^cij 

C3>ZC0rxwHI»t03>3>ni-<OwOrt0tHi-i3>C03>3>t0 



SISISISlSISISISISISiSlSJSISISISINI 

a w u j> iuh * a ui * tuuun * a w 

NWSSSSWNWSWSS 
O^^oi-OOOOOOh-^OOO*-- 

co k u u to o. a co ro co o> ro ro cs eo co to 

S.vs^s.s.s.s.s.s.xs.s.s.s.s.s.s. 

** m rg h o o h ro ijiooohkoou 
cs co ►* ►-■ ro co -o co tn j> co ro co o> u ro ^ 




zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

PiffiRninrTir^r^fflrorornror^rnrorTirnrnrTiRnfflrnr^nRrornr^rnrnro 



r-i-i-r-i-r-i-rrrri-rri-i-rrri-rr-rrrrrrrrr-r-rrrrrrrrrt-rrrrrrr-r 



©OOOOOOOOOOOOOOI-0000000000000000000000000000 © o © o o o 



33 
OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO m 

m 



© J> 



sj ►* in **■ 

u-otco^ ►* u 



ro si ►» u 



ro 

<0 SJ 0> 



j> © © ro eo o o tn hijk o a a o h o> co li -o o ooo<o o~ oj o © si o o ro j> j> ro o tn 

j» © o ro © © © w -o © o ►*■ oo-sioooeo© coo woo^w*- o in o ►» o ck o- © © ►» © u cow© 

1400AOOOOAUOOOAOOK)MOOONOIJOOU40A»UOO»OK)OAAOOUOOpOUOD 
ZZ-IZZZ-1Z-I-!Z-<Z-IZZZ-(ZZZ-IZ-I-IZ-I3-1-IZZZ-I-I-IZ-(Z-I-H3ZX-I-IZZZZ 

nn3>nnr;3>n3>3>n3>03>r)nn3>nnn3>n3>3>n3>n3>3>nnni>3>»'n3>n3>3>nnr)3>3>nnnn 

WUZWUUZUZZWZUZWWUZWWWZWZZUZWZZWWWZZZWZWZZUUUZZUUWW 

00^000707;7 070700070007;07 7. O?;077000773;070"?;0007;3;0000 

a o> o- tn tn tn cs o- tn c* in o- c- in ro o» cn o- o- tn ►* si o- tn o tn tn o« tn 

H -I -i H -I H H >H -IH H -I -I H H -H -H -I -I HH 
33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 

r 3% rr r— r r r rr r i— r rrr r rr rr 

to ro 

© ►* tn 

© co o 

ooooooooooooc*©ooo©oooooooooooooooooooooooooooooooo 



a 

3> 

r 



_ ►- _ ►* *- ^j » i_ f.j h- i-i ^ >- >^ rj k ►* »* ►• ►»►» ►•►* ►*►*►*!— ►» 

si ►- si si sj ro w ro si rj ro sj u si si w ro rj si si co hj si si rj ro si w si ro si ro si ro w si © ro si si ro si si si si w si roro ro 

H* (-* h- I-* ►- ^ >-» 1^ H* h- I-* I— K* )^ I-* »*»»»* 

©OO©©SJ©SI©SJSJ©©C0©SJSJSJ©©i-SJ©©SJ©©SI©SI©SI©S|©©SIS|©©SI©©©©©©SJSJSI 

tnuitntntno-tntntntno-tntntntncKO-tntntntntntntntntntnwtntntntntntntntntiitntntnutnM 

ZXZZZZZZZZZZZZZZZZZZXZZXZXXZXXXXZZZZXXXZZXXXZXXXXX 

I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 





c 




o 




r 


n 


c 


o 


« 


z 


z 


z 


o 


o 




B 


c 


M 


m 


-1 


X 


-< 


w 




O 




c 




r 




3> 




33 


n 


3> 


r 


n 


3> 


o 


03 


IH 


to 


B 




m 




z 


<s 


■h 


m 


tn 


3> 




H 


B 


X 


C 


CO 


33 




w 


h-l 


Z 


z 


o 


c_ 




c 


c_ 


33 


c 


M 


r 


m 


-< 


to 






►* 


« 


<o 


3> 


M 


Z 


w 


3> 




U> 


-^ 


m 


z 


CO 


33 




C 


n 




o 


B 


z 


m 


-4 


n 


3> 


m 


w 


z 


Z 


B 


33 


m 




37 


3> 


*+ 


Z 


■o 


H 


sj 




CO 


33 




m 




r 




to 




B 




■n 




3> 




M 




r 




c 




7> 




m 




(13 




33 


T 




3> 




O 




m 


Z 




o 


►• 


B 


* 


m 








-148- 



w 

-< 

n 

r 

3> 

en 
to 

1» 

2 



U0'U»'Uti|U*»(>lft»UJ>»^UUIUUUI««»»UlH>l»i>k»»UJ>UAUUUI>IO'l!I^UUUlllUU 
mOO©*-*h»-©i-**— ©»— ©0* , ****^©0©**»-*»- k *-**- t '-*i — ©i"*^!- 1 ***- 1 **©**©!-***©©!-*©*-'!-*©*'*©****© 

t J * (D U W 10 OB i» H O h h ^) k K h M S) 9> ( J IJ ►■ k h ^ |J o. I J o O O O O ■« O M O U < M IJ W M O ^ W OS O O ^ 

cooooooooooooooooooooooooooooooooooooooooooooooooo 

O Ul I-.' A O O U UU W W tl U A 4> U W U IO K O rj H m O h IO k J> O-Ul tu? O-UI J U ►• U h e A r J r j U I J A J> M u 
KMtKHAA>'(l'WIJKOvJAJ>-OOHAOMOIOIJ'OA>OC''SJO'\IO-!M>Aa)-CtM>CDffiO>OtJII)0-H*AM 
IJ0'-0CHMM(MJ0)>0Ol.1A4>!M.llU1.1-0lJAa)^a)IJ(tlOW.l>WOOl.U!t>'CDO'-WMOO\J>'HOtUll'fl 
>»I>2>I>a>l>3>3>l>2>I>»>B3>I>3>I>l>l>I>I>3>3>l>I>I>I>l>I>I>Wl>2>I>I>I>2>I>l>I>I>>3>I»I>J>I>J>> 

nwnnj>ri=i-nr-i3>3:«i - 7jnninri3: 
oomrn33>i-im3>o-i3>i>ro3>i>i>oo3> 

EZODMKIZinirn^SMZZCtllO 

■ni-imm^i-iT'cr! mj>i-i-i<cz-t-i-4i-i«z 
rnjj!H-icjnEziiionooo»B)iiio 
z»ccr-i-mjOHOZi»7zz c r 
tn MHrm>oco»z m *n w w 

r r o z r o o mr> 



33 t_ 

PI 3> 

■0 2 

a i 

a? ►» 

h « 



H O I -< H 

pi o j> 3> 7? 

-4 Z i-i H 3> 

O 2 2 PI C 

zmmmrn 

m 3>U) 5? 

3> c n w 

-i n m r 

w 2 

-i -i n 

-< m >-i 

33 -I 



onzrio 
r o on 

rj -n -n c O 

"0 r~ i-i -t 

c 3? -h c en 

c x -i m c 

ZMinrM 

r r r 

n r 



d tnron 

hCTI» 

x 3 i> r- 

O w 2 >-i 

Z-lH|Ti 

00)2 
2 X -I 

m 
■n 
o 
x 

H 



n e 

i> o 

i- o 

m c 

2 >-" 

-4 i- 

m r 

m 



e n m 

►h O 3 

nrz 
x c m 

w 3 -H 
-IBB) 
3>CB 

cn c 

73 

o 



33hT| 
C TJ 3? 

-i to i> 

r - e 2 

m >-< ?- 

« n c 

O X i-t 

m r 
r 
m 



cn e tn 

OS"" 
O C 3? 

w m m 

-< 3? 2 

r o 
b -< "n 

>h m 
to r 

■< © 



m t_ m 

C 3> 2 

r n z 

niTM 

tC 03 01 
0) O 

2 

n 

2 



E 
15 



HOiixzsHZ/TCsttzzs^SHHiiiiiH-ti-jxriiiornnHreiiztQzoz-^z-izzzt 

Biri))Hiiizn-<)>Hrrcciini)i/i))ZDJ)zzox-<))i>nj>!)»x)>j)rir3)(.iirnx3ia3J3 

SISJNJSInJv4nISJV1NISJVJ-sIN1N1vJNINInJnJs1SInISJVJNJnIVIVJSJn1VISISJvJn4SJNIVISJn;nINISIVJsI , MSINIvJ 
U0<U^UUUAAUJ>O>UiktiAUCHI|UUAAAAUeU1J>AJ>J>All|4>UAUUUUt)>UAUUUUUU 
\N.N.N.N.X v V v N N \N,N\\ v v\N.N.N.N.N.N.\\VVN.VK\VNvN.N.\VVN.S.\N,VVN\\N.S.N,N,V 

i-* ©©©**■ t-* O*- t ^*Ot^-OO^ -, ^ ,- 'H*0OO»- fc ^*0^*i^' — • »-* O ** i-fc *. ** ©©©©©^»-*©©*-©*"*©©h*©©o© 

o*viuo^vio^oo^^eooooNiro*K*^woootJcvi-»ooocoa3'OS30-o^(Bi>i-'>-h»-ONirjeo>o-ovj 

VN.VN»N.VN\N.X\V.VVN,N.\Nv\%N.N»%VN.S.\%\V\VN,NN.\%N,V.N.N.N.V.V,N.V.V,N,V.N. 

M O W O ^ f H O >* U ►■ >* U U W 10 O IJ O O O M ^ h W O O i- k O f IJ I J O h U O >- IJ ►* W H h w h O h M W O 

rjo>A^oviviNjMHMuo>'»'<oi>i>0'0<OD-<seii<oa]AMin-o(Dcii<0'OAMOsi'aA>ocDa»i>Mau)MOUi 

QOOOOOOQOQOOOOOOOOOQOQOQQOQOOQOOOQOOOQOOQQQOOQQQOO 
3>3>3>3>3>!>3>3>l>2>3>l>3>3>3>I>»I>3>I>I>l>I>»I>l>I>3>l>l>3>I>3>l>I>I>l>J>l>I>I>3>3>l»I>I>»I>a>> 

»— ■ -*• i **■ *■* »**■ »» — ■»*■ ** *** ** •*■ »*■ "» ■» »— ■ **■ »" "•■ **> »» *» "* •*■ *» •» »» »» ■ ™ tn rn rft rrt rri rn tn rft *ft i"r\ tn rft rrt fft rr» en ~~ 



»»»3>I>2>X>»3>3>J>I>:>I>3>3>:i>T>I>»I>I>l>3>3>I>:>3>3>I>I>:>I>I>I>I>I>3>3>3>3>I>3>3>3> 

Oitntotntntowtntotnoio3tno5030)0)ojoitotoo)toino5tnwojoioiojo)0)mo>tno)totptoiniotoioio 

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 

rrrrr-rrrrri-rrrT-r-rrrrr-i-rrrrr-rrrri-rrrrrrri-rrr-r-r 



ID 

o 

rrr 



r 
o 
o 

z> 
•4 

M 

O 

z 

M 

z 
n 
w w 
z> e 
-i pi 
m 2 

-4 

to 

M 

z 

c 

o 

r 

n c 

o w 

3 Z 

2 O 

O 

© c 
i-i m 

-4 I 

-< w 

n 

c 
r 
» 
x 

n i> 

i— n 

i> n 

to w 

t0 e 

m 

z 

© -I 

m to 

2> 

-t © 

OOOOOOO^-OOOOOOOOOOOOOOOOOO^OOOOOOOOOOOOOOOOOOOOOOO X c 

10 3C" 



tntno)too50)too)0)wwtototnoio3 
o o o o •- ■ 
r r- r r 

2222222222222222222222222222222222222222222222ZZZZ 

pirnpiRPiPipiPiPiPipiPipiRPiPiPiPiPiPiPiPiPimPiPirnpiPiPiPirriiTirTiPiPiPimpiPiPipiPipiR 



■n - n - n - n - n"n"n - n _ n - n - n - n-n-n-n-n-n-nTi - n-n - n - n - n _ n - n"n"nT|Ti-n-n-n - n^-n-n"n"n - n"n - n"n - n - n"n"n"«i-n-n 
i- ri-i-ri-i-r-t-rrrri-ri-rrrr-rrr-rrrrrr-ri-rrrrrrrrrri-rr-rrrrrr- 



z 
t_ 

c 

0©©©0©©©©i-'000©00©©000©00©0>-'00©0©©>»©©0©©0©0©©0©©©0© t-4 

m 
tn 



M 

►*• M ro tn i- »-. 

i- o> o tn o a o tv <o 



m-h* *■* i— h* LI JS- LI O 



01 M 



■« ►- uium tvrj^siw NitflH* 



►•HtiiK\ioooooo>Ji\i o vj w < on t* to ni o © rj tn © >c oj» owoi-oooow 4ooauou 
wwotnoooooootnNi otvoj>->--a)o>-'00ojkOw>-i-'w oowoowoo»H'0oo*tiiO'00i 

OOOOOOOOOOOONOOOOWO'0OI0OOCIi'O<IO*UCOO'0tlOJ>OO«W»OOOOO»O 
33-l-)-l-i33-)H3-l333-l3333-l-l33-l3-l33-l3332333333H33333333-l 

nni>>i>3>nn3>3>n3>nnna>nnoni>i>nni>n3>nn»nnc-innnnnnni>onnnoonni> 

UU22Z2UU22M2UUU2WMUU22WU2U2WU2UUUUUUUUUUZUUUUUWWUZ 

co?\^. t^~ oo7!7;o7;ooo7\oooo7r. ^oo^ot:oo7:oooooooooo^:oooooooox 
o>tx t>-oi ro tvtvtn oitvtvoi tstv t>- o~oi t>>tnoitvo>Lit>-oic. , io» tvoit>-i>-t>'0>tnoi 

-I H H H -H H H -I -4-l-l-(H -« -H 

33 35 33 33 .33 50 33 33 3333333333 33 33 

3<3\i—r7?3\7? r 3<r-3<rr r * 

u 

►* A 01 

tn © © u 

oooooooooooooooooooooooooooooooooooooooooo©©©©©©©© 



o o 

3> 3> 



o 

3> 

r 



B •« 

1> SI 

3 U 
3> 

O H 

PI X 

10 33 

c 
o 

O 

Z PI 

-• n 

3> PI 

-> 3 

Z 9 

33 PI 
TO 

» I- 

3 < 

-4 VI 
19 
33 



H-0HrgMHMM^'>JIOMMSJ>JMM\JMM'>JMMMMNJMM>JWMMMMMMMMMHMMMM'^MMM^M 

orj©ooovjNioosirjooo©ooo©oooooovioo>josisioooNiooooo©ooooooo 



c 

33 
PI 

tn 



OIOIOIOItnOIOIt>>OI010l010IOI010IOIOI010IOI010IOIOIOItVI>OIOIOIOIOIOIOIOIOIOIOIOIOI01UIUUIOIOI01UIOI 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXSX2X 

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 



-149- 



3D 

m 
n 

c 

C 

co 

m 

en 

o 
t: 
-i 
m 




Ul U Mil u 

o ►» o o ►- 

*» •■* r j -o m 

o o © o © 

MMSIHU 

wtflH ro o 

O i-» m u r J 

» » » » l> 



3: I r 

-< 3> 1> 

x> r 

t. m a 

y. -c zn 

i> <i i> 



wen* t> u u u j> j> 

© © t— **©©!■***** 

CD 0» M M ■« >0 ►* M M 

ooo oooooo 

1- IJ -b UIO^AfH 

j>ut co o o> ui o* ui 

u ui r j w <o * u »* m 

» I> 1> I> X> I> !• X> I> 



O "OSO "0 

rnmi 

3> -t> O 

o i> o m 

m r « z 

cz M 

ZO X 

» 



inoczincEniiiESOJ^coiiinrMHMUzcnoiojZEmEiiii-iri^Mj^ni* 
rpjjoB>H>jH-(MHir-<»>n>»»r>NMi»jjr7NPi>Bcno2iii)(ii»N(B>»N 



SlSJSlSISlSlSlSISlSlSlSISISISISlSISlSISISISISlSISlSISISlSlSISlSlSISISISISISISISI 

u u lui ui luuii yi * u u ui in u u w * * * * *»mi>*o>*>*ais>miuwh» 

s.s.s.s.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S^S.S.S.S.S.S.S.S.S.S.S.NS.S.S.S.S.S. 

""■►*»»»»►» >»»»©©©©©©o©>*©©©>»© © O ►» 

kl u t.l k^ hi ki i.^ m (h. ►.* K* r.l r i m ►. 1 ** r.l tk. ^» (in -v I f ■ ►. * 



NJ NJ Nl Vj >i 

* U M" U U (.Ul H LUU1 Ul A U U U Ul U 11 W 

S, S. X s. " 

~- ** O O 

ro ►» r o co 

s. s. s, s. 

mo^ r o 

nj w -c in 



SSSSSSSSSSSS.SSSSSSSS^SS'SSSSSSS'XSSSSSSSSS 

H*©H*t-**-*©©©©******©©©©©l-***»"*l^>***©©©©©©0©**©©©^©©©** 

OM^OOO-^hhkOO^hm^OMhM^MMhOAWMUWUIMAMAOOOnJWM 
S.S.S.S.S.S.S.S.SvS.S.S.S.S.S.S.S.S.S.S.S.S.S.VS.S.S.S.S.S.S.S.S.S.S.S.S.S.S.S. 

»MNfl.HH( ) INH>'MOHUI0t*NMIJONt»HMOW>'HMM>»Oi*l'MO 

iU9.<0<9>HOU»'WMMMOIJUM*0>l!l'0>CWWAfUI»>W*UIWC)'C'C'« 



SI SI SI SI SI Si 
A U W U » * 
S. S. S. VS. S. 

►*©©»-* m> i^ 
© si CD i- " " 
S, S, S, S.S, s, 

UfMMMU 

© SI CO ►* SI © 



■x 
m 
■v 

o 

-I 

z 
o 



n 



n 

h m 

m z 



DQCIQGQQQQOQnOQCICIQQQQQQOQQClQQClOGICIQQQQQOQQCIQnQQQQOQn 

I>J>2>X>I>3>X>X>3>X>X>3>3>1>I>I>J>3>»I>X>»'I>2>»I>»3>»»1>I>1>»2>I»X>»:>I>»»»»3>»:&»I>J> 

iiii.oui'ii.'luininuiriuiiDiiioitiiuiiiitniiiiiitniiitniniiiiAtnintntouaiifluiniiiiiintDiiKi)" 
oosooooooooooocooaosooooooooooooooooooooo 
r-r — rrrrrrrrrrrrr-rr-r-r-r-r-r-r-rr-r-r-r-rr-r-rr-rrrrr-rr 



rr rrrri-r 



zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

rn m rn m n n rn m m m romrnrornrnmrnm mrnromrnmmmrnpi nrnrriFimPiFTiniH mm m m m m rrpi mn m 



to 



z 
c 
o 
r 
n c 

O HI 

z z 

z o 
o 

c c 

« rn 

i z 



mmmmmm^^mm^m^m^mmmmmmmmm^m^m^^^'ii'ii-Timm-'i-'i-nmm-n-n.m-n-n-n-n-n-n 
r-rrrr-rrrrrrrrri-rrrrrrrrri-rri-rrrrrrrrrrrrrrrrrri-rrr 

H 

oooooooooooooooooo»-'Oooooooooooooo©ooooooo ooo oooooto r 

CO 



O00»'0>~000000000000000000000000000000000©000000000»' 



» 

7) 

n > 
r n 
> n 

10 w 

to e 
m 

z 
a h 
n to 

» 

a 
z c 
to 7 



M Z 

z o 

(_ 

c c- 

7} C 

m r 

m -< 
to 



** ►- Ul 
o u ro © H> 






to ui m ui ro 



OAUIOO A si Ul J» si © © A © Ul si CD U W SI © ooo © ►» en © w © © > © © o 

oo©oo OOO O O © © CO © © 0- © SI O CO © si © © © ©OH. o ooow*sioo»»o 

©©©©©OOOOOO©^O*OOUIOOOOr0CDroOSI00OLnOOOOOOOOOOOOOC0AOOOUIO 




M Ul cb ro w 

W O h> U M U 0> 

0- © ►- W CO SI * 

OOUIOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO<0OOOOO©OOOOO 



o 
2> 



ooo 
> > > 

r r r 



o o 
r r 



z <0 

-* SI 

a 

» 

PI 

r 

(0 



•* M> t— **►»►*►» ^ 



to **»»»*»« m ** ►* w. ** >* »* m- n* m- n* i-fc »* h* ro »* r j ** m> m> hj ro ** 

MtOMslslslsiSIMSIMMSISISIWsltOSIMMWSISISISISIMSIWH>MslNSISIOMNSIMMSiSI»»M>l»»slNI 
SIOOOOOOOSIOSISIOOO^OSIOSISISIOOOOOMOMOOOOOOSIOOOOOOOOMOOOO 



tntnuic*ui^Lnu!uiuiuiuiuiuiuiuiuiuo*tfui>uiuiuiuuiuiuuitfu 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 
llllllllllllllllllllllllllllllllllllllllllllllll.il 
zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 



o 
o 



-150- 



2> 

n 

w 
o 

30 

—I 

m 

D 

* 

-< 



3> 

tn 
en 

3> 

Z 



iBicii»n7f)ii)iiwt«»»L£rHin , !in«M(i)£MLiLB(i)Br-i2iiir«oiBinnii) 
o5!*23>oBrrjHOj>»ooMj>j>cHrnoo3T 020M»mi»»cPi7»nronor» 
zoT)i-"N23>-<rn3: zzw>3P>-ii-ior>er:*;7?- wzrt-^c-nr-ozoKrnocjrcnemzr-osozc z 
sorociHS M , 5Ln7Hj()iii)i7BPi'9"?ZBrcNMO'iiNm7njEi , ii , in rwinnHMTii 
o7nzrMii) z ozifl53wmm3iflMPMr-ir-<3M27i j>cnoen-orzr-j>ori-i» r z z 3> o 
rn z -t i n <: ciidcooi o o z 3> z pi o pi w r o t; n z c s? en » o -o » r » ■< z en » o o en 30 

j> o n c m •-• pi z w -o z zzoz j> z -1 en c jo »■«-< so c o z o r -h o -h z r -t o a 

c2Hjjrr 73»nr ec-to en o "0 en *zr * 30 o o m o o pi o 

pi -1 en r r o or mo j> z 30 pi r "n h en j> c z 

z -<Hon m 30pi rz z 11 Ti>mr j> z z z 

z r-iz j> o j> en r 

pi m q en -h en 

30 (0 (0 

oiHHO'iij23;»»ii)criMMC2 2iojioiBM4nn2COi>»> , njrHio7oiHHTi 
io)r2»rMC-(NNfn>POB>n-<r7MO»u)>2xo»e>»i)iPNrrr>XMiMir2xr 

tuuu* W Ul 01 tn LI i w w M^ tn 01 Ul U U W W U U U » W U LU: LI 4> Ml t»- tk U U 01 tl W H » fr 'J tl Ul U U til u 

0000000000000>*000000000»-00»-0>-000000»»000»*OOOOOOmmOm 

UJH.SI^WUWLJ>0O.fr-J>OWHIJUIJSIC0»-\IOIJLIIOHOK»KM-UOMfflAO^>'UHfflKKHKCi 

W O f o IJ k 10 |j (J u h >• h o O IJ IJ O 10 h ij » o >- O O O f o u U >"* O " lj O h W » O >• *• W O U O O N w 
M)HOMUI<0OIJ0><0UIIDMUI»D>0>Hai^MH»O>'MAUOHH»Uft'U>K)U<C0'a>MO>'«>J><UN)O 



r 
o 
n 

3> 



o 
z 

M 

z 
o 

O «-■ 

3> e 
-i pi 
PI z 




ZZZZZZZZZZZZZZZZZ7£ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ:_ 

pipipimpipipipipipipipipipipipin* pipipipipipipipipipipipipipipipipipipipipipipipipipipipipipipipi 



Tl-n-n-n-n-Il-Tl-Tl-n^-n-Iin)'T|Tl-IlTlT)TlTlTl'Tl-fl-?)'T>'TI-Il-I)'ll'Tl-tlTlTl , 71-TmTltlt1TlT|"TlT1-t1T1-Tl-n-Tl-HT) 

rrri-i-rrrT-T-rrTT-i-rrrrT-rr-T-i-rrrrr-rTrrrrrrrrrrrr-rrrf-i-rr 



H I 
-< w 

n 

c 
r 

9> 

n > 
r r> 

j> o 

en -> 

eo e 

pi 



oooo»*ooooo©oooooooooooooooo'>o©oooooooo©ooooooooooo 



ooooooooooooooooooooooooooooooo^oooooooooooooooooo 



»- efl w m 






M. « ►• 



O M O 01 



eo eo vj ►- -o •» 



0- W CO Cv O Nl CI 1- ~ O O CD © © N) O CA © ►» ■•OC0>**O<OU>* © -0 CD -0 O Ul tl h * * UfOU4 o 

*o-oooo* ouoouoo oouou ©o«-si©wni© © ro >-> j> eoooLtouiuoooouo 

©U©©OOOOOOOO0>OOOOOO©OOOOCDOO'«*»<.0O00ICNOOO©O0l'eOOOU©OOenO 
Z-tZZZZZZZZZ-tZHZ-«HZ-«HZZ-l-4ZZZZ-lZHZZZZ-IHZZZ-(ZZZZZZZZZ 

n3>nnnnnnnno3>rJ3>n3>»n3>>on3>3>nnr)n»r)»nnnr)»3>nnn»nnnnnnnrjn 
uzuuwuwwwuwzcdzuzzwzzuwzzuuwuzwzuwuuzzuwwzwwwwuwwuw 
oxoooooooooxexexxexxooitxooeo'i 03*0000:* 3*. ©ot?«:ooooooo©o 



0- 0- 0- 01 



30 30 
r * 



7 7 
r r 



50 30 

r r 



30 30 

r r 



o >- K> 
1- © © <o ►* 

*0 O C/l o © 

00000000000000000000000000000000000000000000000000 



CD OO 

r r r 



pi a 

» 

z c 

eo to 

M 

M Z 

z o 

c_ 

C '_ 

2 r 

pi >< 
eo 

B <0 

J> Nl 

Z U 

J> 

O H 

PI z 

CO 30 

c 
o 

O 9 

Z PI 

-* n 

3> PI 

•H Z 

Z «D 

30 PI 
3D 

J> ►* 

z <0 



30 
PI 

r 
en 



M>JM>JNI>JWW>J>JMNrO>jrj>J^>JNINN^»J^^>JM^M>JWM^**M>JWM'«J»*>J , '4W>J'g>J>JNINjNJ 



NI©NIOOONI>-©O©OOONIO©OO©O©©OOOVI©©©NIOOMf0O©Nj©SJ©OO©O©©©©© 



UUIU1U»UIUUUUIUIUIUU1UIUUUUIUIUUUIUUIU»UUUU»UUIUUUUUUU 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I 
zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 



-151- 



33 

m 
n 

□ 

3? 



IS) 

o 

33 

-t 

m 

e 

w 

-< 



3> 

10 
05 



O 

o 
o 



o 
o 

o 
m 

CO 




(DO-O- MMU WLl) i 
©OOOOOi-O© 

tntnyjuuiNiOAro 
©© ►- oo o o o o 

OMOhhWOMU 
CD h U O O 0> M h ». 
<0 4H OOEh ^ OUI>' 
3>3>3>3>?>?>3>?>3> 



30 t_ 

PI 3> 

T> Z 

O I 

H Ul 

Z H* 

o <0 



oTur 

3> M 3> J> 

BONH 

3> o m o 

ni n c x 

OEPin 

z 3> r isi 

-< r 



tix rn j>h 

2> ]> w o m 
7IMBHO 

M7>or 
zo zr- 
wz -n 
ch > 
7J r 
o r 

(0 



z w z pi 
j> w m to 

IOOEH 

i m 

c to n 55 

M 3> 3> O 

r zw 

r oh 

m -<r 

pi 



n(i)C302^T!2or7(i)cc-ionn"!c?;cii)nrnt£2J02>HEiJzo>(i)HOH2-i-niii 

>n>WS3-<>2»C-<nHH2I»-t>H-<HB»3>>-<l.SIIN2CMS-<IJ100^2(iirx>r 




uit rf N^uwM*wuyiv^uww\uJU'^#NVN^*y*yiuj^t>N^rJuJuJwu i, y , «^U'>iNyi.iiMwiM^ 
3>!>3>I>I>l>3>I>l>I>I>a>I>J>3>2>3>l>l>l>I>3>2>I>3>2>I>a>3>»I>3>l>l>2>I>I>I>>l>I>I>2>3>2>3>J>J>3»3> 

(fluiintniouuuiuuitauiuimainiAiflinioinuuiuivitniooiuiinaitniointnoiuiiONtncninuiaiaittitoinnu) 
oooaoooooooooooooooooooooooooooooooooooooooooooooo 



totoiftifttototototototototntntntototooj i<.< '.m u.< ^« v-* «.' u.< ■•.' '« ?.<.■ >„>> ■ j j uj >j> m.'j .■.., j.- ■ .>.■ 

OOOOOOQOOOOOOOOOOOOQOQOOOOOOOOOOOOOOOOOOOOOOOOOOOO 

; » *— r~ p* r - p* p* r - p* p* p* r* r* r* r rr r 



■uuuuuuuuuuuuuuuuuuuuu 

rrrrr-rrr-rrrrri-r-rrrrrr 



• r r r r 



zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

pipinr^niPinpiPiPiniHPiPimpinpipiPiPiroPiPinropiPiPiPiPiPiPiPiPinPiPiPiFiPiPiPiPiPiPiPiPiPiPi 



ri-rr-rrrrrrri-rrrrrrrrrrrrrrrrr-rri~i-rrr-rrr-rrr-rrrr-r-r-r-r 



©ooooooooooooooooooo©ooooooooooooooooooooooooooh*oo 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



10 M 

i- tn .«» o> o> 



ro ro 

tj o~ &■ tn m 



M 

01 Ol ** 



<0OOMUNUM 



W AM 

►* U M ►* to >■* W H tv Ul O 



z 
c 
a 
r 
n c 

O M 

2 Z 

z o 
o 

s c 

m pi 

-t x 

•< •-» 

n 

c 

r 

j> 

n 3> 
r n 
3> o 

CO w 

en b 
m 

z 

O -I 

m to 

j> 

-4 a 

X c 

10 39 

M 

w Z 

z o 

t_ 
c s_ 

35 C 

»h r 
m -< 
to 



ro j» © © o ro omooowo o © >o *» -ooooomooo *o tn otn ^uiouioohooo oo 
© tn © © © u o w o o © o o ©o©o>»-u©©o©oooo tn*o orotnooooorouooo oo 
oooootn«ootnooooooooowfo-ooooooooooooocoooooooootnoiooo©o© 



-< z 

3> O 

z u 

7. O 



ZZZZ2ZZ22-I2ZZ-IZ-IZ 

nnnn(-!nnnn3>nnn3>R2>n 

r-i r.i r-i r.i r.i r.t r.i •» r-i r-i f-i *v f-i -r M 




UUUWMUUMUZWUUZUZUUUUUUUUUUUUUOJbJUUUWUW 

©o©©o©©©©~ooo?:o?;o©oo©©©oooooooo©ooo©© 

ui t>- tn tn &• o» tv tn t* o>M u cs ff.o-«^>'M».oi9'0>uiKo>>>e>o>oiw»>ui 

H H H 

30 33 30 

r r r 



© © tn o> o> tv o &■ o~ a* 

H 
33 



h* ^ffljtf r o *» .t» .r» ts j> * w ro 

CD < © i-> © ro OIOOvJOhO>UOUUU 



i-0»tflf>»-'0»i-'NlW 



O Of Mt>UU«M »■« 
© OOwO'OOOOOMhO 



wi- vu w ij w ^i s^ ■— ir vi <J Ul U U \IOUOi-HOet»>»'0 © O©i-»0'©©©©OMt"»© 

OIJOOOUUOUOOOOlOOOlMOU'OOOCXhl.ilOOHAOMOHOOOUOOOOUMNO 

•■~.©^0G0©©©©©WLno©©NJ©«©tn©©©©©©©©©Mtn©©©©© 

DOCIDCICIDCIS)C)OOOC)QOG)QQC)QQQOC)C)OOOt!C)DC10QOCIClQC)QOQOOQ 
3>»3>»!>3>2>3>3>l>3>3>3>3>I>3>3>3>3>3>I>3>»»J>I>»3>3>3>I>3>J>3>»3>»>:fr»»3>3>3>3>3> 

T-r-rr-i-t-rrrt-r-r-i-rrrrrt-rrrrr-rr-rrrrrrrrrrrrrrrrrrrr 



V f J l-' V <-> »>J I - 1 «w> L»J ^-* ^^ ^»» l-'l ^-> ^-^ *^ (-'i 

OOOOOWOOtJOOOOOOO© 



3> >J 

z w 

3> 

m x 

to 33 

c 
o 

o s 

z m 

-i o 

3> m 

M Z 

z w 

33 PI 
33 

3> ►» 

Z >0 

H NI 
00 
33 

m 

r 

CO 

o 



M M M tO ►* M M M ►* MM MNN MMMM M MMHN M M M M M M M »0 »• f ►» ►* 3> 

w w w to m w ro m to ni w ro m w m ro m to nj m m ro nj m ro ivj ro to ro w w nj m m io m m m to w w m m »- m m nj ro vt ni hj 

c 

roto row row ro rorororo roro rorororoi-' ?o 

ooooroorooororooororoooorooooororoororooooororooooooooororototooNjOO pi 

to 



xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



o 
o 
PI 



-152- 





111 


o 


a 


r* 


o 




z 


Ul 




(9 




« 




a. 


cc 




m 




Ul 




as 




3 




-1 




M 




« 




U, 




a 




(0 




-i 




Ul 




ce 


a 




rs 


h- 


ON 


z 


^ 


<r 


CC 




ui 


ce 


a 


z 


z 


M 


Ul 


« 


u 


t- 


Ui 


z 


a 


o 




u 


3 




a: 


en 


X 


Ul 


h- 


a 




<x 


m 


z 


N 


<r 


C* 


a 


*■« 






en 


> 


Ul 


-1 


HI 


3 


ce 


T 


3 




~t 


a 


Z 


z 


t-» 


M 




ce 


0) 


3 


i 


a 


1- 




<t 


(0 


Ul 


i- 


a 


z 




bl 




a 


Ul 


M 


CD 


u 


« 


o 


-1 


<t 


u 


cc 




« 





XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I t I I I I 

xxxzxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

winwwinwinr/winininininwuTinwininin^oijiuii/jinrirt 

OCMOCMOOOOOOOOOOOOCMOOOOOOOOCMCMOOOOCMOOOOOOOO©CMOOOOO©Or<l 
CM CM CM CM CM CM (M CM 

CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM IS CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM f ^ CM CM CM CM CM CM CM 
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM y* CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM 

I I I _I I I I I » I I 1 — I — I — I — I 1 — I — I — I — i — J — T I I I I t I I — I — I — I — I — I — 1 I I I I I 1 — ) — ! — J — I — I 1 I — 1 

««««««<z<z««<z««««z««<z<r<z««<x<z<z<r<z<r<z<i<z«<z<E<z<z<z<r<z<i<i<z<i«<r<i<z<z<z<z 

■<OMOoooooo<omO'»a-oooif)-ovooowooooooooiiTooors-ooMoo'<rooooon 
MW-«©o©oo©©-<f«)iiirtMCfOM)<o©fsocoorso©<roocDOOfs»*in©cKO*or)©orso-oo©©fs 
n o cm oo o © o n «h >o © -o o cm o >o ui «r is © o o is o cm n c i rs in cm ^ -o cm -o v cm o cm is c i cd -< -o © o tn ui 
*-cmcmv-oco»*«ois n cow v *r t ro^-co a cm is n coco in w himnod »in cn -o m rs is >o 



ic 
cc 



cc 



< -o <o in n o <o in 



_i 
ce 



tc 



<o<o<oin NO'Oin -o -o-o-ou") ui in -o^oiom-omiiT *o o< in >ou">-o-o-o>o>o-o-o-0'0 

©o©©oooo^oi£©o©0i:oo^oo©©©©0'i;ooo'3^ooo©©o©oooo^. 

MmmnMMMMZnzr»)MniozronztonMMMMrizt*iioMi*izrinMMMrimMroMnz 



■O -O UT 

o ^ o ^ o 

PiZMZ« 

£ i- £ i- r 



MMMnMMMMZnzmnrniozMnznnMMMMrizMfOMrizriioMMMrimMroMrozM 
cjuuuuuou<zu«uuuu<zuu<zuuuuuuu<zuuuu«cjuuocjuuucjucj<xcj 
zzzzzzzzi-zi-zzzzi-zri-zzzzrzzi-zzzzi-zzzzzrzzzz^Kx: 

^U")©0©0©OV©CM©mWOW©rtOISIS©00000000000*-©UT«rrt©©00©00©0©0© 

inpi»oooiiio*o»'Oci'<NHOi , )oi>)noToo«ioooooiiToi)>o<rri-0iiiooooonoO'0oo 
>oooooinoTMrti , )OH cm a in cm co « o ©omoo-ootiso ui>o>oi«)«-ioou-)rs© © rs r> o © 



** ■* * in in on 



*■ -< CM i-l CM 



»* w *• in 



•c © 



»< h » o n 



»< id >-i m «i t 
■<r ^ cm 



ooooooooooooooooo©ooooooooooooooooooooo©ooo©o^©©©© 



X ©0000©0000©0000©©000©©000©00-rtTHO©oooo©©©o©©©o©oo©o© 



I — I I I I I I ( I I 1 — I — I — I — I — 1 — I — I — I — I 

U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 



i i — i — i — i — i — i — i i — i — i — i — f i i i : — i i — ( i i — i i 

U.U.U.U.U.U.LLL.LI.U.U.U.U.IJ.U.U.U.U.U.U.U.U.U.U. 



z 
o 

1-1 

H- 
<r 
u 
o 



lllLJIjJUJldljJliJUILdUJUJWUJUJUJLdUJLJlULdLJLdLUUJUJljJUILdLiJldLdljJld 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 
I 1 I I I I I I I I I I I I 

000000000 0.3000 

cococowcocnuicouicnuiwcnui 



_i_jj_i_i-j_i_i_i_i_i_i_i_i_i_i_i_i_i_i_j_i_i_i_/_;_i_i_i_i_i_i_! 1 _; 

ooooooooocoaooooococoocoooooooooococ >- 

muii/iinininminoitnwinwiorawwwunnuiwciunnicinwunninKiiL-i';!.-, t- 

«<x<z<r<t<z<z<z<r<z<r<z<z<z<i<z<r<i<i<x<i<r<i<r<z<x<i<xc<r<z<r<ic<ic >-> 



inuiuiuuiuiininuinuiinuiinuiuinuiuiuiminininin^inuuiuiuimuiui 

«<t«<t<E<t<t<t«<t<i<i<t<t'«<t<t<t<E<t<t<t<r<r<t<r<t<t<i<t<r<i<r<i 



QOQQOODOQOOOOC3C hi 




000 

v. -s s, 

is is is 
IS is is 



is <r if) C-; © 

O CM « CM CM 

s. v V s. s, 

•O > Mil •<! 

o © o o o 

s. s» s» s. s, 

rs rs ~o cc is 

rs IS fs is is 



HBinzao:oo:^o:<iiioej«<NZui(i)jZNKo<iuouu>->7>-yiv(iijs<c(oajxuuHaz 

3HlZ(IKUOO{U^4<1.7«ZZZHZ{«lHZUUI(ll^Z3ZZZ3Z{Z3^Uli.hnHCCi: 



K Z 

<z o « 
3 z a z 

Ul O <t Ul 

i-mzb 

h«UI3 

X cccc o 

3UOJ 



Z Ul 

~ z 

CO 11 

ui x <i 

O Cv _l 



z 

3 

o <r ui 

z z _i ui 

^ j «jja ce 

z jz>mjjw xui ceuci. 
^ZbiuiD^HU^jHomuui u a r-" » 

030o<n;>>-io_izzi-i ouiumOl;>£ 
Kjb.iHuiH<ca-)ju.jjoui<i 

"* X UJ 

ui <i in 



UJ K 

IJO 



a h- >- a _i o ^ jii.ZHUiH«a-)ju. j jo 

JhhZMS3U JZIOIOit JO JZOD-3 
UIihi-i<ZI-ZUJ<£U|i->3 Xii.<Z3H-UJUIUI<Zu. 

tojuAU)uizz>3acou.(nuceu)ci4i-_ii-ui 



o 
z a 

uj a ce 

_l H- 

jin k 
>-. r z 
z> <z <z 

M >-i CI) 

i!JC 



UJ 

C M _| 
U. 3 LL. 



<z 
3 

Z 
3 <Z CD 

<r 3 z 

cc 1- cc 

anL 

£ £ U) 



u. a 
x a z 
o hi z c 

huUU 

mO J d 
JJQZ 




hi A 

cc o 

z a o 

G 0. Z 3 

H- — <t Z 

_l _i X — 

3 _l Ul _J 

O <I _l _l 

£ CD <Z UJ 



O u ce 

_l c 

Ul ^ _l 

3 <r <r 

a. _i a 



<i <i <z <i <t 

-0 co n ya © 

c «c n r. 

r> ui © tn rs 

o © -* © o 

is -< a -< -0 

o ^ o © o 

^J IS IS IS (S 



Ul 

ce _j 
H- ui >- _j 
£i-hm j: 
« ui — ^ cj 

: - juic 

ul >• 3 i 

C 3 C C 3 
_l X — JC £ 

<t « -r <z <i <: 

«C — © LI > -• 

"I n r^ j; > .- 

CO c ^- C3 r^ «■ 

o — © o © — 

-0 -O © *s -c -c 

O O " o © © 

rs rs is -o 00 rs 



-153- 



o 

CM 

UI 

CO 

<t 

a. 



xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

•oinuTUTuninininurinuTUTininuTinininuTininMiininin'rinuTUTUTMiinyTin 



OOOCMOOOOOOOOCMOOOOOOOOCMOCICIOOOCIOOOOOOOOOOOOOOOOCJOOO© 
CM CM CM CM (SI CM CM 

CM CM CM CM f -I CM CM CM CM f -I CM CM CM CM CM CM CM CM CM CM CM CM CM CM £M tM CM CM CM CM CM CM CM CM CM M CM CM CM CM CM CM CM CM CM CM CM CM CM CM 
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCM CM CM CM CM 



a 

(A 

_l 
ill 

tc 

CO 

N t- 

o- x 

u cc 

a> z 

x M 

ui <t 

u i- 

UJ z 

a o 
a 

3 

cc en 

X UI 
h- co 

<E 
M X 
IS C 

o- a 
en 

> UI 
_l w 
=1 CC 

"7 3 
-1 

a z 
z w 



__ji — ! J — r __t — i — r i t — i — i — f i — i — i — f — f — t ! — i — i — i _» : i i ! i i i i — i i _j i : j — i — i — i i — i j i i i i i i — i 

<£<r<t<:<r<i<r<r<tc<r<t<E<i<t<i<t<t<t<r«'«<c<i<r<t<r<t<E<t<i<t<t<t<E<E«<t<i<i<t'«<t<t<i<E<i<rc<r 

OOOO0O00(3 0U(jQQO0OQ0Q0(3OQO(30OQ0OQQOOOtD0(3tD0(3l3O0OOO(D0 

©ooo-coooooisoooorxociowoooooinuiciocioooooooooo'Oooor'jouTooo 

OOOH^fflOOIilOD'OOMOBOIIIOrtOOOOQVPlOO'rinOOOONOOIllbl-OOIllOriliiriOOO 

© ut ui w ro rx in cm o th is o n ui cm © n o o © <r © © * m ih m o* ,-( © © o o rs rx o m ui <r w co cm © *-i co o o in 
co *i -o w oocM«r <rrytiy-inc><TO'\nT<Bfrrt<D<T B^mnaiinvHrirtfirii thcoo-cm cotcdv 

jj -J -i _i _i _i -J _i _i _i 

cc cc cc cc cc cc cc cc cc cc cc 

I- I- H-K KK H- h- I- l-K 

m iiT*o -, o *o *c "O m *o»0' , o>o*oiiT >o *o *o "010*0*0*0 w *o *o ^ >o *o *o *o *o *o *o *o *o *o *o *o *o 

O^^OOO^OOOikfOOOOOO^OOO^OOOOO^OO^OOOOOilOOOOOOO^O^CO 

MZZMnnzMnMr^zMMMMMMznMnznMi^MMZro«znnronMznMrof<5r<iMMZnzMW 
u««uuu<cuuuucuuuuuu<cuuu<cuuuuu<cuu<£U!juuu<ruuuuuuu4:ucuu 
xi-i-xxxi-xxxxi-xxxxxx!-xxxi-xxxxxi-xxi-xxxxxt-xzxxxxx>-xi-xx 

o©ouT©ooou7 0©oocoocioci©coooo©©ou-)cioo©oo©ir)oooo©©©ooi-(u-i©©UTO 
o© ©©©tr)CMomoocMna3©o*©TH o© oo«ioonoooon ©oo©ouTUT©--<.r s .©o«TO 
00 © o ut ci *-i o cm ut o co r*. ci ui o ci — on 00 OTOOoot ©uToointsco©© 00 © 



o co 



win 



«t ^ m 

IN 



WO — 

in 



ci ci n ci co m ci 

ci «-i t CM 



•* cm in <r © co 


© 


1H *M 


CO O — 


*■« O 


CM «**t *-i fs eg 


n 




IS -rt 


UT CM 



r*)oo©©©o©oooo©oooo©©ooo©o©o©©o©©ooooo©o©©o© 



00000000 



CO 



z 
lil 
s 
1— 1 
u 
o 
<r 

ce 

<E 



3 

a 
x »- 

UI 1-1 

^ a 

o 

CO X 
Z X 

>H O 

©■ o 

-I 
o 
3 
z 



X MOOOOOOOOOOO 



000000000000000000000000 — OOOOOCMOOOOOOO 



-l-l_l-J_l_l_l_l_I_l_l_l_l_l_l_J_l_l_l_l_l_i_l_l_l_l_J_l_l_l_l-J_l_i_l_l_l_l_i-J_l_J_l_l_IJ_l_l_l_l 

U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 



UIUJUIUIUIUIUIUIUIUIU1UIUIUIUIUIUIU1UIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUI 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 
— * i ( 1 £ 1 1 1 1 1 1 1 : 1 1 i i e 1 1 « s 1 1 i i 1 1 1 f 1 1 1 1 ; _i ' 1 ; f 1 1 1 1 1 1 i i 1 i 

00000000000000000000000000000000000003000000000000 

(ncncncnencncncnencncncncncncnoTcncncnwcncncncnincRcncncncnroLOCiicncncncncncneflcncntnoTincnw 

<i<i<i<r<t<t<i'<r<i<r<tcc<i'«<c<r<i<i<t<r<i<i<E<r<E<i<i<!:<E<i<t<r<r<t<E<E<t<r<r<t<t<i:<r<r<i<t«<:« 

(30Q(30ua(9oaooooooooooo(9C3oaaQi9oaac3Qooooaooacatsaoaot30 



en 

ui 



u 

z 

O ti 

CO 

0* o 

-h 2 



<tii:<i<t«ci:oofic>-><tC!:jO(fl>H>(n50Mi:uj«j>-uo(flUJi:it>->uiNNu^o^i-i>xa>- 
^<n-ii-i^oruazzuau.uxzxz^:zuzoz3>-<^cncnxzzzz^zz<r<£Z3(no3^Kx^u. 



ui 

_i <r 

JO -I 
UI CC K 
3 <I CC CC 

ui z « <r 

N2MU 
4UJ> J 
KBOU 



UI «X UI 

4. 3 CD 

o <r 

a <r y- 

r r lc 

ui <x <r 

u. CJ CJ 



ui 

X * 

o cc 

x <t 

Z u. 
UI I- 
uj UI 

_l UI UI 

a 3 ui 

co en a 



s 

A 

Z 
O 

h- 

s 

>- HI 

Uh 

cc z 

<T 3 

XX 



cn 
co 

z co 

w cc 

cc UI 

0. > 

cn x 

r •— 
cc cc 
<i o 
3 u. 



CO 



X <I 

<c u 

3 1-3 



cn 

CO I- 3 CO 
XZ M Ci > 

4HU UI 3 t- 
"3 CC 350<[m 
30.XU1OZI-ICJ 



cn 
« 

X 

M (Q _j 1 — — 1 ^u.AUJUA.nu: 

z_i _iccxi-_icn3>-iccuiA z 

«<iuiuiui<ruii-iijj 03UCi^ao<i3 
z^z jizi jiho z 3 >-. cc x _i 
cn cc>-_i^zs:_icccnzjc<t-jQ.ixi<£_i 
<IUI3<IC_|i-i3<X<C o_icco<xui:e<t 
_iaA3Xui3cnx3cn_iuiiXiuccxoco 



3 M 

o 3 

cc 01 

o <r m 

U, 1I1 3 

CC 3 O 

O U _l 



3 
O 

UI 

z u. 
a u. 
1- <x 

WOK 
UI 2 01 

h- ui a 

>-i a <r 

x _i 
3 z 



u. 
<r 

t- a 
cn cc 
to o >- 
<xu.ee 
_i x <i 

U. O CO 



o a 

cc cc 

3 O 

iZt A 

Z k cn 
•« HU 

K « UI _1 

cc cn _i 1=1 

<r _i _i a 

LL. 3 M M 

cn i- x 



z 
3 
o 
1- 

Ul X 

Z CC t- 
3OL0H 

OCffiC 

h- •-< <r <t 

WhNH 

oijm£ 
O <X _l 
CC IB UI Z 




>- 



-154- 





ui 


«4 


a 


CM 


o 




r 


ID 




a 




<L 




a. 


(£. 




Ui 




UJ 




cc 




3 




-1 




t-* 




<X 




u. 




a 




en 




-j 




UI 




as 


00 




N 


t- 


0> 


z 


!■* 


<£ 


CC 




UJ 


CC 


a 


z 


r 


W 


ui 


<r 


u 


1- 


ui 


z 


a 


o 




u 


3 




a: 


CO 


z 


UI 


h- 


(9 




<t 


W 


r 


N 


<r 


0> 


a 


»■< 






01 


> 


UJ 


_l 


»-» 


3 


cc 


1 


3 




"J 


(3 


z 


Z 


w 


M4 




cc 


to 


— 


z 


a 


1- 




<E 


in 


UJ 


K 


a 


Z 




UJ 




a 


tn 


W 


0) 


U 


<c 


O 


-j 


<t 


u 


oc 




<t 




J 




3 




u 




11 


> 


Z 


»- 


bl 


l-l 


3 


a 




o 


O 


z 


z 


z 


1-4 


o 


3 


u 


-1 




o 




3 





zzzzzzzzzzzzzzzzzzzzzzzzzxzzzzzzzzzzzzzzzzzzzzzzzz 
I I I I I I I I I I I I I I I I I I i I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I 
xxzzxzxzzzzxzzzxzzzzzzzzzxzzzzzzzzzxzzzzzzxxxzxxxx 

sjsiininssininifjssinuiinssinnincjifjinifjininuitnin^ 

©ooocmooooooooocjooocjcjcmcjoooooooooooocjooooooooooooooo 

CM (M fM CM (M CM CM 

CM CM CM CJ CM CM CJ CM N CJ CM f J CM CM CM CI CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CI CM CM CM CJ CM CM CM CM CM PI CM CI C-J CJ CI CI CI 
CM CM CM CM CM CM CM CM M CM CI N CM CM CM CI CM CM CM CM CJ CM CM CM M CM CI CM CI CM CJ CI CI CI N CI CI CI CI CJ CI CM 



I I 1 J I I f ! t E I I f f ! I I — T — I — I I I 1 I I I I I _J 1 1 I I J I i J I I I 

««<E<t«<i<r<r<r<t<r<i<t<t<t<E«<t«<i<i<t<r<t<i«<t<r<t<t<i<i<t<r<r<i<i<t<t<i<r<i 



I I I — r i i t 

<t « « « « <z <t 

GO GO ID GU 



OObl 
V -O F> 
00 CD t 



OOOOO-"OOOM-H«roOOOOO0DO-<OOOOOO-0O 

o^ooorvr*ioo«rif)»«r')ooo©orjotf3 o © o c © s; o 

rv in *-« as in v »r 

■On TTH 



oooooooBiiT«roooio>ocioooooooo»HOOoM»H«rooooooaDO« 
oir)iiiiiirtO<rM(Booin>fflfiooooHoooNfloo»m'<nooooonoiii 
OHriri ot csoowrva3«ro<rrvcNCjf)s3cj>om©oov»-io in in co o S3 sj m m 
•oinTM 1 rv .hoocm co c j *• -o cj in cj m »< ro in co -o » cm cm r\ «r co m «t rv -o 



in-o-o s3mmm>o-o>o>oin 



as 

I- 
If) ID If) S3 



_l _l "4. 
u£ CC CC 



X. -J 
Of Of 



iC -I 

CC lC 



C£ CC 



in <i 



m S3 S3 in S3 O S3 



■O -O •<) »< If) (V -0 



., -» ^ -» », .. ., <.-.-.-»■! u, y> u. -u «. -v. ii < < ii o o -o «o ■« « >g h m i\ < <o -o 

oooisoooooooooiiooo^o^oo^^iiooooooo^oisooooooo^jio^^oji.; 

MMMZMMnnr!MMMnztoMnztozMMZ2zMMMMMfonzMzronnronr^Mzzr!2zri2z 

UOU«UUUUUUUUU<IUUU<£U<EUU<X<r<XUUUUUUU<£U<XUUUUUUCJ<I<£U<rCU<X<E 

zzxi-xxxxxxxxr>-rxxi-x>-xxi-i-Kzzxxxxzi-xi-rzxxrzxi-i-r'-i-zt-i- 

OOin©OOOin©©©©0©inCD«->fvOOO©in©©Omin©OOOmin©00©©©0©©0©0©©>0© 

© © tv © o © © oo oo m o so r> m o oooo»-n«oooif)00»4 ooooooossoooocs: 
oo^omoo oif> oo cotijt-<i^o n-oon co iv m m n o iv ooossvoocjo-oocom 



in o n n o in in 



■^ O 

If) 



«• -H »< If) 
f) 



*-• ci to 
r*> 



in o o ~ c-i o if) 

If) »s «<3 W «T 



cj if) n if) — 

CI IV 



t-4 *-t o o o 



■^CJOOOOOOOOOOOOOOOOOOOOOOO^OOOOOOOOOO^OOOOOOOOO 



0-rtOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO'HOO«-<000000000000 



I — i I I I I i I i i i i I I i r s I I i j f i i i i — i i i — i ( r i i — i i i i i ! i i i i i i ? 

U.U.U.U.U.U.U.U.U.U.U.U.U.U.U>U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.LL.U.U.U.U.U.Ii.b.U.li.li.lJ.U.Ij.U.U.U. 



UJUUUliJLJUUJyUUIUJlUUJlUlJUJUJUJUIlUUJUUUIUJLdUULyLiJUUJUJUJuJUIljJUUJUJUJLiJUIuj^ujLjtiJuJ 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

_l_l_l_l-J_l_l_l_l_l_l_l_l_i_l_l_l_i_j_l_l_l_l_l_l_i_i_i_i_i_J_l_l_l_l_l_l_l_l_l_i_l_i_!_i_!_!_i_:_i 
ooooooooooooooooooocoooaooocccooooaocoooooococcooc 
en en to co to to to en to tn lo lo tn tn in in in to in in tn to in tn to to tn in in in in to ui m oi tn in w u) w w w u) in w in ii ^ ui in 
«t'0:«<:<i«<i:<t<t<r<t<t'«««<t<t<t<i<r<r<i<i:<t««<r<i<t<E<t<c<i<x<i<r<r<E<t<r<t<r«<i<t<t<i<i<t<r 

QOOaOOOQOOOGGGGOOOOOOGCOOOOQOCJOOOOGGQOGQljQOOOGOGCn 



Z 
UJ 

a 

O 

z 



»4 4 

© *4 1-1 

•OON 

V. N \ 

-o -o ~0 
in rv n 

:> >- z 

3 Zw 



CD O 

IV C-l 

O r* 

N *0 

u a 

UI T. 



CJ CI 

CI CJ 

o o 

rx ts 

rv is 

z> 1> 

z z 



CD 1*1 — ' 

•H O O 

"V V N 

-h -O CD 

o o o 

S. V v. 

iv mi rs 
mv rs 

_i<r z 



> 

ae 

3 X 

z m i- 
o K-t- <t z 
Kiaza. >-< 
uj ui a z _i 

U 3 X « O X 

Z iu; uj i- a 
Hauiz js 
cc _i _i o uj <i 

0. O U X A_l 



ec Z 

ui — a 

ZJOI- 

-I iC UJ 2 
X _l i-i 
O v=i CC Z 

3 o <r lc 

<L OX « 

J3UU. 



Ill T PI 

CI CI CJ 

V V X 

MllO 

o o -< 

V X, V. 

fs «0 M3 

n iv rs 

X > <t 

O Z m 



Z X >-c 
<I l-i u 

_l z 

iU« 
U O 3 
O X o 
Jllh 



ill »r n ck iv 

o o o o -< 

V V V N V. 

CD -O CO CD Ch 

o o o o o 

V V V V V 

IV >o fv rv iv 

iv iv rv iv iv 

I- «-■ Z Z J 

53l-l-« 



Z _l 

3 _l 

a »-i 

z z z 

<t « z 

_l Z >-i 

i-iet 

3 UI (J 



O "i M 

V \ V. 

K) CO CI 

O O rH 

N V V 

03 IV -0 

(V IV IV 

>■ >- z 

Z Z X 



V V V 

CO CS CO 

o o o 

\ "v v 

IV >o IV 

IV IV IV 

CJ X u 

to t- CO 



«r o co if) 

-< CJ o o 

V. V N V 

CO UO «0 111 

o o o o 

V. V. V v. 

tv *o *o ^o 

IV IV IV IV 

X X -J -I 

z a u. u. 



if) en «h 

CJ -< CJ 

V. V. V. 

CO CI o 

o -* ■-< 

X v, v. 

IV <l IV 

rv rs iv 

a <t _i 

tn z> u. 



ck rv ui 

o ci ~ 

V V V 

CI CO CJ 

O O w 

V, V V 

rv rv -o 

rv rv rv 

a -j <r 



♦r iv co o> ci rj 

ooorio cj 

V. v. v. V, v> \ 

O > »0 MJ -- -0 

■~ O O o ~ o 

V V V V V V 

CO CO CO CO CO CO 

rv n n rv rv rv 

«0«ZB)h 

:> (j a k ^ 3 



rv cj 
o — 

rv rv 
o o 

v. \ 

CD CO 

rv rv 



If) a ci 

CJ »- CJ 

N. V V. 

•OMil 

o o o 

v x v 

ro co co 

rv rv rv 

_i co i- 

u. x x 



as «i rv rv »r 

cm o o n h 

V V. \ V. -V 

rv iv rv cv cs 

o o o o o 

V V V X V 

CO CO CO CO CO 

rv rv rv iv rv 

mZIIOJ 

Z Z O i£ i-i 



M UI cc 

Z> _l UI 

01 * lC 

<C O <L 

z x s 



to 
oc 

to 
ce 

_i ui 

>- 3 _l 
Z 1 UI 

€ a. > 
a <z 
_l i- cc 

<r to >- 



z 
o 
l- 
to 

UI 

JC -I 

u cc 
o <r 

A X 

a u 
3 
_l Z 



«««««<t*«<:<iit<t«<i««<iii<t«««<i<:it«it<i««<t<i>t<t<i<«<r««<i«<i<:<i 

IV O CI O CJ ||T UT CI -4 f I CJ CO O- S3 CJ O «-l M3 <l «T M O O- 111 O- rv -o if) <r <t ut iv ri w ui a- rn ut o <r o co iv «r T 
rv-ocoouT ci ci»fUTrnco ill >UT«ooMs)^»rrv«fiv<rnrorocs<io3«^mcDrv-HLTooocN«r<j-<)fv 
u") co rv r*i ui <r «r *« t ut ut <t o iv o> o o «r iii m -* v ci ut iv co co co -< o o rv jn rv ot <r if) if) m >o o -* cm <• ~ 

OOOOOOOOOOOOOOO-h-iwO-hOi-iO-h-hOOOOOOOO- 



i<t<z<r<r<i<r<r<i:<t<i<i<r<i<r<r<i<i<t'i<i<t<i<i<r<r<i<r 

i cj -h ri cj co o- -o ci o -. mi o «r r-i o o- iii o- rv S3 ui <r «• un rv ci w 

iTUimcoiil>ui«oo. , *is3^«Trv«j-iv<rroroncss3a3»i<rcD 

-■ i-i «r ut ui «r o rv o. o o «r iii m -< »r ci ui rv co co co -< s) o rv jn rv ., 

O0O00OOOOOOO000-s-iw0-h0>-iO-h-<O00O00O0OO-»O00O— — o^o 
^OCJCOCJCOCOCJS303COS3«mS3COCOCNMCD-HCDOCOCOS3S3S3CKrj-srt>CIOCN|VIV^i|vrvlVIVIVS3 
OiH-HO»sOOOOOOO.-<OOOOOOOOO^iOOOOOO-<»-iOOrt-<OOO^iOOOOOC 

M)>o^)ixs3rvNrvs3iviv-o>orv<NivN03ivrxN>oivivs3S)-orvs3ivrvivs)cocoo3cocoo3eocor*)coco 

• • • 



to 

z >• > 

o a i- > o »- 

O UI >■ ii I- « 

CC UI I- U ZmUIXvCUUI 

CC<IU.UJi-i Z ZU3U^Z J Iil J 

oi-i_izoi: o tooi-o <rozo3D_i cc 

z<iz _iz i- zjici-ojiixtua — zzo 

Xi-i Hi500l[<IZWJI-HZ m u « G a 5 CO in 

i-auitni-iu.f-u.Zi-i^i-i-iuioi-cc'-ien^zz n i-a 

3i^»ilLjt03uiuDt«jixZUDZiuiZ 
I4«M«3H<IjLCi- O^t-vCvtUUIi-O-jCcCCO-i 

t-to_jjccetorzu.i-itn3X-io')tnxzci.r>ccu.oc3Z3 

<t <t <r c <t 

>C "C r; < 0" 
CS O -■ <T X 

ci v- ^r m iii 
o c o o o 

CO CO CO o o 
c o o — -< 
CO CO CO CO CO 



-155- 



IIIIIIIIIIIIIZIZIIIIIIIIIIZILl.LLLLLt.Ll.t.LiLa.LLLIlllLl 
I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 
uiinin«44iflininin44iom«ininwininoin4inin4i/>intnininin4inin.H*4wininininininininininin 



OOOOOOOPJPJOOOOOOOOOOOOOOOOOPJOOIV© © © OOOOOOOOCMOOOOOONO 
CMCM tM i CM w 

NN(\lNNNNWNC\INNNWNNWCJWNW«r<NWNWN^NrsN(NMWNritS^Mriwrj(Nlf^nrs©^N 

N N N N M N « rtNrtNnMPINNMNNNNNNnn N»h i k NMNNriMNN CM w i — — -■ 



I * I 1 — I — J — J I — 1 — I 

<r<i<t<i<r<i<i<i<T<i 

UOOQ (30 (DOU C3 



— I — I — I — f — I — I — I 1 1 E I t I I I ! i 

«««««<r<t<r<t<t<E<r«<t«<i<r 



I I — I — I 

« « « « 

oooo 



i i r i 

<x <x <x <t 

oooo 



^'©©OOO'VOOOOOinOOiHrvcOOOOmOininOO-OOOOOOOOOOOOOOOOOOOO©©© 

noHoooniiino m -o m o rv voooNoonooo oooo ©on© 

iH»nonoB*NNO ui on mom ■oooonMi'on^N in <r in o in n o in 

n - n t n n <r n m n ooro^oos pj «o o in cm pj o *• >o •* mod *-■ n»h 

-i _i _j -i £ *: _i _j _i _i _i * ce _i _i*_i_i_i** 

ce ce cc ce ce ce fie ceae ce ce ce « ce cececececece.ee 

K H I- I- K t- I- I- K- I— I— i— U t— I— t— I— h— I— I— i— 

•O OT <0 n >0 •<) W "0 -O S3 W 4 4 -O "0 O 4>0-o<0«0<0>0-o >0 -o -o -o 

JiOZZOOiiOOOOOOZOO^OOZOOOZiiOOOOOOOOii^Z^OiiOOO^^^^iZ'ZO 
ZMZ2MM2MMMMMM2Mn2WM2MMW22MMMMMMr*>M2222M2MMW2222222M 

«0<Z<EUO<IUUtJUU(J<:U(J<IUU<rCJUU<t<ruUUUUUUU«<:C<EU<EUUU<E<I€C<E<IC'^ 

i-zi-i-zzi-zxzzxzi-xxi-xzi-zzzt-i-zzxzxzxxi-i-i-i-ZH-zzzi-H-i-i-i-v-i-z 

MOVOOOiOOOOOMONOPJOOOOOinOPJOrvooOOMOOOOOOOOPJOOOOOOOnoin 

looooinnooooon^oo' o oorvooNOCNOOOomoomoo oo-oo o o o © © pi o -* 

nOHOOHNOinMOON4l>10D O ©O Ot-iO^-OOWOiMO Pi MO O On rv th © w O © O P J w 



novinon 



n IO ID ■rt in v M 
M CM 



M O 

rv 



MwM^-CMM-rtW 
CM NHN 



O CM 



i-i •HOOOOOOOOOO*400000000<HOOOOCMOOOOOOOOOOOOOOOOOOOOOOOO 

3 
"5 



en 

x 
t- 
<r 
tu 

a 



0O0000O0O0~4O00t40OOOOOOOOO0O000O0~hOOOOOOOOOOO00OO00 



— I — I — 1 I — I I I ! I ( _* I I I I I — I — I I I I I — I I f * I I ! I ■ I I I 1 ( I i I — 1 

U.UU.UUU.UUUU.U.li.UUU.UUU.U.UU.Ultl^UUUU.U.U.UU.U.UU.U.U.U.UU. 



r f i i i f i i i — i 

.U.U.U.U.U.U.U.UU. 



UlLJLJUILJLUWUJWLUUIUlUUILUUILdUIUJLdUIUJljJIjJLJUIliilxlUlU^ 
2222222222ZZZZZZ2ZZZZZZ22222ZZZZ222222222Z22222222 




m •-! ** «o 4 in cm pi m >o in <o eo cm >o ■* *r c ■> cm o cm »h on pi ** o n o -o m pj in oo co rv is c i ** on »h «r <■ »r m o ~i <r i o m 

o n n o m n o m n « h fi •< n o f i n n n « o o n o ^ o <n n o o o m o o ri in m n x n n « »< « rt r i m h o o 

V^VV.NVVV.VV.V.NV.VV.VV.V.V^^V.NV.xv.N.V.V.V.V.V.V.V.V.V.V.V.V.V.V.V.v.V.V.V.V.V.xv.V, 

■* ■* o -*h o» in o o». ■* co i © o« -o o* ■* oo it i -. o cm o- on as -o cm in rv o in •« ■** tv © pi ** c i ■* en i ~ pj cm cm r j cm m m n 

hOhhO©!1©iiOii»hOO©t-iOi1'»hi1'*<!iO©00!hO©iiOO©©ii©Oi©©©©©©©©©©©© 
XV.VV,VV.V.V.V.v v V.V.V\\\\\\xv,V.V,v,v.v.v.\\V.V.V.V > v,v.v.v.v,v,v.n x v.v.n v v.v.v.v.v.v. 

OOOOOOOOOOMOOOOOOOOOOOOOOOOOMMmM^rvrvlvlVM^'Orvrvrv^^'^^^'^'^ 

rvivrvrvivNNrNivrvrvrvrvrvrvNrvrvrvNrvivrvivrvivNivrvrvrvNfvNrvivrvrvNrvivrvrvrvivrvrvrvrvrv 





« 






u 


z 




o 


X o 




-i 


H- 2 

ae ce 




H- 


O UI 




Z 


3 => 




UI 


00 2 




a 


a oi- 




M 


<I W 2 




u 


3 Z3 




2 


wO 


o 


►i 


3Cl£ 


CO 






ON 


O 


<i <r<t 


1 


2 


CN H 

w pi »r 


m 


h- 


O CM o 


ii 


CC 


o o w 


1 


o 


ihNh 


2 


0. 


ii O n 


<r 


UI 


co oo o 


1 


ce 





« I- 

Z )- fiZCU) 

<X UI 1-3 2 3 ii 3 

hiaz«o «oaa 



co a 

a z 

z « o 

•i _j ce 

ce (0 3 

a. > Ma 

en ui z 
in a: <t in <t 



ui 

a. 

o 
x 

UI 



0£ 

ui > ce o 

k ce ui ce 

« in ui ►- 3 

3 i- z z in a 

22UI2OOUI10 



. UU U4 uj u~ M. UJ <J- LU ^ <£. UJ 

H>-(aijcjzci«ii.«uzoi->-jOHHOiiiazi^ 
X2<ztninrui 33-iu_j^-ooce<zao_ii=iiii3i-cuce 
uza3ZJuiiiijjaujzu<i«aaNiiceH{ezaz<i 
wui<eo>iuioiioo2X^ocx:cl H<toc[tiouH j 
3h-3U3inceceuun(nac»-mininz>~)XiZiinz_i3u 



<x <x <r 

S3 IV CO 

© <r ui 

th M -i 

ii ii © 

•rt © IV 

H*HO 

CO o o 



<t « « <r 

© o m o* 

cm o> «r -o 

M w o »h 

»H © © 1- 

© o cm o 

H 11 O 

OOOO 



J«H 


0>UH5 


<c ce ce 


K w <I 


X 


TNI 2 


<t i- 


in 


U.U 3 Z 2 2 


Z 2 


0. o O U X3 


K 


« ►- (J Z 


in 

-1 
















>- 


CJ 

>- 
















K 


O 


ce 


UI ^ 










UI 


M 




UI 2 


-i ce 






> 3 


01 


_J 


u 


a 


1- O 


_i « 


Z 


t- 


ce _i 


<z 


UI -1 


z 


UI 


OTwC 


m a. 


<c 


ce 


3 3 <I 


in 


>- ll 


U -J 


i- 


ui ce i- 


^ 


z 


o >- >- 


SB _l Z 


<r 


Ui => 


o. c 


ce 


ui ce 


uUJZ 


UJ o 


a. 1- t- 


a o i 


_ 


Ji X 


C w 


a 


ce ll <t 


<r 1=1 uj 


M 2 


3 n n 


O Z -£ 


s 


U CO 


z z 


00 


<r > a. 


hi >• a 


O UI 


UI 2 2 


O O <I 


<i 


3 <C 


O >i 




z X in 


z X UI 


a ce 


2 3 3 


3X5- 


_i 


cci z 


-1 -1 


UI 

ce 
<r 


<i <r <t 


<t « <r 


<£ <t 


<I O 1 


<e <r <r 


c 


<E <t 


<t « 


cm >r »r 


■0<9- 


i M 


IV Cn O* 


«■ i pj 


iH 


<T n 


pj rv 




iv ri n 


1 CN (V 


<r >o 


PJ PJ PJ 


oo * «r 


LT 


rv © 


o -c 


0) 


CM m <t 


cm in © 


© o 


-coo 


PJ M M 


O 


ii M 


fn M- 


Q 


o © o 


o o o 


o o 


o o o 


o o o 


O 


o o 


o © 


ce 


rv i co 


1 -T CM 


PI PJ 


ON PJ PJ 


M CJ PJ 


ro 


M M 


M M 


o 


o o o 


w © o 


o o 


o o o 


o o o 


© 


© O 


© © 


u 


M «■ IV 


tv IV (v 


<r «r 


>o tv rv 


fv V * 


<r 


V V 


*■ ^~ 


UI 



-156- 



0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 
I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



oocMoorsxoxorsoooooooooooooxxxorsxorioorsxooxpixxxoooxxorj 

CM **«4^4v4 ** v\ W *H iH Cl 1-4 »* «* CM H* *4 V* rt 9< fj 

(M CM CM CM IS CM CM N CM X CI CM CM N CI CM X IS CI CI IS CI X X CI CI CM X CM «h IS CM CI 0> CM C-l IS CI N M CM CM CI CI X CI hs CM IS CM 

CM CM »* CM -< N N N M W « •< f UJ h N n n « ^1-1 P4 »h »h PI -1 CM -1 " 



CO 

_l 
111 

oe 

CD 

IS I- 

CK X 



-J -I -I 
<Z<l<Z 
OOO 



( 1 __( I I 

<t <r <t «r « 
00000 



-i -i 
o o 



-1 -j -i 

< <r <t 
000 



-i -1 
o o 



oiiiooooor i ooooooo© ©oiiioooooooooooosjwooooooooooooooooo 

thoo -1 00000 wop) o» x © o in o o 

cm 10 o inisomo ^^ mo-n oca p o 

n<r i-i v *r -< »h ci sa t cm o is «oo © o 

cm 



I J J J J J S£ 

cc cc cccc cccc 
i — t— I — I — I — i — 

-0 -0 



_i _i \c _i _i 



i£ _l _l 

cc cc cc 



— i 1 1 1 

a. ci.ce.cc 



cc ace cc 



i= — 1 — 1 — 1 i 

CCCC iCCCCC 



-I -1 



_l -I 



ss SO S3 



■o-o-o 



S3 o <i o 



zrozzzzzzroz2222ron222M2222Mtr>r*)2222r')riri22222r)rir»)p022 

«o<t<E<i<i««o<i<r<i<r<Euu<r<i<iu<E«<r«uuij<i«<t<tuuu<t<t<t<E<t'- 

i-xi-t-i-H-t-t-ri-i-t-i-i-xxi-i-f-ri-f-i-t-xrxi-i-t-t-xxxi-i-h-t-i- 

oooocMom^ouioooooooooo-oo^onooo-oooooo^ooTisoooooo-oooooori 

OOO O S300.HOOOOPI O O © O O If) O HOOD OOOU100CN-00000 ocooo B O ^ 

© ui in <r two moo in ©x © © ^ o o> w o> o o pi o»sooomsj-<oocno pi ss © © S3 w m 



i- x x z x i- k 



W S3 

^OOZ^ 

2 i") m 2 2 

<E U U € <I 

I- X £ I- I- 



O ri 

ro 



iOHHOin>H 

CM O 



w If) O 

-I CO W 



I*) CM 1-1 W O 
If) CM CM 



OMoniiiMOOM^ « m m o 

t IS O *NNI«I ^ PI 



CM T 

cm 



w OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 

cc 

3 



OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 



— I — I — I — I — I I I I I I I I 1 ( I I I I — t — i — I i I I ( I I — I 

UU.Uli.UUUUUU.UUU.UUU,UUUUUU.U.UUUUU 



— 1 — I — 1 — ( — 1 — I — I — I — I — f — I — I — I — ! I J I I I 

U.UUU.UU.UUUUU.U.U.U.UUUU.U. 





ui 

3 

O 
2 


a 



X 
X 


UJUIUIUIUIUIUIUIUiUIUIUI 


UIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUIUJUJUIUIUI 


cu 


UI 


Ul 


Ul 


LU 


en 

Ul 




3 



u 


2 2 2 2 22 


2 2 2 


2 2 2 


222222222222 


2 2 2 2 


22222222222 


z z z z 


Z Z 


r 


r 


2 


z 


z 







1 1 1 1 1 1 


1 1 ■ 


_l 


-1 -I 


—1 


— i 1 F — 1 — 1 — 1 I — ^ — 1 I I 


1 1 ! 1 


I t 1 


-J -1 


_l 


-1 _l 


1 i 1 


_l 


_/ 


-1 


_l 


_. 


_l 


— ! 


_j 


. 


_l 


—1 






O 




OOOOOOOOO 


O 


O O 


a 


ooooaoooooo 


OOOO 


OOO 


O O 


OOO 


OOO 








c 





c 


O 





a 


C3 


a 


>■ 




3 




co co in co ui en 


CO CO CO 


01 


CO CO 


en 


CO CO CO CO CO CO CO CO CO CO CO 


CO CO CO CO 


CO CO CO 


CO CO 


CO 


CO CO 


CO CO CO 


CO 


CO 


CO 


CO 


CO 


CO 


00 


00 


00 


CO 


00 


u. 




2 




<e <r <t <t <t <r 


■« ■« <r 


<t 


<I <c 


<r. 


<t<i<i<t<E<x<t<i<i<i<r 


<t <t <I <t 


<r <i <t 


<I <t 


<r 


<t <r 


<I <t <E 


<r 


<t 


<x 


<r 


<L 


■c 


<I 


c 


<t 


<r 


■c 


H- 




H 




000000 


000 


O 





O 


00000000000 


0000000 











OOO 


C3 


OOOOOO 





U3 





O 


jj 




CO 




9> O S3 If) CI If) 


^ «t 6 


■0 O If) 





lf)iHT|SOt»>IN©-H<lf)© 


<T UT O T 


O M IS 


X 0> 


<r 


S3 V 


x 





S3 S3 


CI 


0- 


T 


X 


uo 


n 


Ul. S3 


X 




K 




ONrtrtNO 


n 


*-4 


TH *h 


T-* 


n th -< h pi -< n N H H 


-« n — pi 


■** PI 


PI 


O 


CI CI 


O ro pi 


PI PI 


PI 


04 


rH 


.-# 


CM 


— . 


X 




2 


111 


X X X X X X 


V N N 


s. 


s. s. 


s. 


SSSSSVS.NVNV 


s. s x s 


XXX 


X X 


X 


X X 


XXX 


X 


X 


s 


X 


X 


X 


X 


X 


X 


X 


X 


x 




Ul 


r- 


n n * h w <r 


TOM 


<3- 


i-t rH 


CN 


PI IO 0- 111 If) PI IS If) PI S3 S3 


S3 Ul S3 S3 


is X S3 


X X 


03 


X X 


O S3 CO 


X 


0- 


0-- 


03 


r< 


X 


1H 


O 





c 


ri 


^3 




a 


« 


000000 


O 1+ O 


O 





OOOOOOOOOOOO 


OOOO 


OOO 





O 





OOO 











O 


*-< 








~< 


^- 


~. 









hi 





X X V X N. X 


S \ \ 


s 


■s s. 


\ 


S.S.N.S.N v S\> v v.v v v s 


N. S. S. N 


XXX 


X X 


X 


X X 


XXX 


X 


X 


X 


X 


X 


X 


X 


X 


X 


X 


X 


iZm 









<V -0 -0 rs <T T 


t -0 «r 


3- 


«r N 


<l 


IsissSTTIssSTrsTT 


fl- <T T V 


«r t t 


S3 S3 


S3 


<r «r 


t «r 


S3 


«T 


<r 


T 


ro 


T 


[S 


T 


T 


T 


S3 


Z 




2 




rs IS IS IS IS [S 


IS IS IS 


IS 


IS (S 


IS 


rsisrsisisisrsisisisrs 


rs is rs is 


X IS X 


X X 


IS 


X X 


XXX 


X 


X 


X 


X 


X 


X 


X 


X 


X 


X 


X 


< 




z 


~> 3- CC CC 2") 


x 2 <r 


O 


a cc 


<t 


>-imi-<«>-i>>--)H<<r2 


1 cc <t 


j- <r 3- 


O 2 





<X <L 


_l h- 1- 


-) 


Q 


w 


p 


a 


2 


X 


r- 


>- 


« 


u 


to 









2200KZ0I-U 


X X 


u 


XX(£OX3^2XOI-aOUU 


2 0. 2 u X 


£ 


3 CJ 


"-• 3 O 


2 


M 


1-1 


1—1 


1— • 


HH 


H- 


2 Z 





0) 


<c 






1- 












X 


(9 




























a. 






u 






u 


Ul 


O 











J 










z 


















1-1 















-1 Ul 


cc 






X 


z 


3- W 


4 2 




3 3£ 


















_i 






3- 






_l 


_l -I Ul 





a 







_J Ul <t 


Ul 





<t 


CO 


Ul 


O 3- 


Q 
















01 




z 


|Z> 








w 2 _I_J 


a 





Ul 


<£ 


-1 z _i a: ui 


CO O -1 


a 1- <t 


O 


Ul 


^ >-" 


z 


-1 










Ul 






l~l 













r- 


3 O Z >-« _l 


2 CO 


Z 


CC 2 


Ul 


« <t 2 ui _i a k 


t— Ot Ul 


-13 3 


CC 


_l 


2 3 


cc <x 


Ul 










-J 










r- 


Ci 






z 


z i- oe 3 w 


3 Ul 


^ 


O iC 


£1 


HlO!l)i62M K2C0 


x 


Ul O O 


O Ul 


u: 


<r 


a u 


l-» 








Q 


-I 


>- 




_; 




co 


u. 






Id 


^KUIDiii 


<r ui <t 




2 3 




42I-2303OHUH 


2 062 2 


<-i X 1- 


2 _J 


<t 


a > 


3 Z 


L. 






>■ 


CC 


*-M 


1— 


4 


■I 




UJ 


h— 






a 


CC Ul _l Cb Ul Ul 


_l t£ lC 


t- 


*-* w 


<t 


UIUIC0Uiac0l02O3X 


O CO Ul <t 


L. LC ^ 


<I 


X 


z Ul 


O Ui u 


Ul 






LU 


<r 


> 


^^ 


73 


CC 


z 


_i 


^ 






i-t 


<ii-ac5i-ti: 


uCkQ 





1- kl 


J 


u.uZ >■ <iH"Oiii0.u. 


h Ju 


t- Ul Ul 


H- u 


(J 


LJ -1 


JUh 


^rj 


>- 


>■ 


-J 


c^ 


H 


3; 


x 


b- 


^rc 


y£ 


3 









3 CO Z O 2 V 


H£CZ 


_i 


_l 


1^ 


wzizzaaji- x 


CO _J _l CO 


CO h- Ul 


ii O 




Ul _l 


—1 •— cc 


Q 


c 





CC 


t 


CC 


■— 1 


Ul 


z 


CJ 


c 


^0 






z 


ui ui ui ui « 


<t 3 O 


HH 


<Z O 


:> 


UIUIOO<I<CO UJ <£ Ul 


■-> c 


Ul CO X 


O 3 


H- 


cc <I 


M CC « 


HS 


cc 


cc 


3 


<i 


O 


wC 


« 


LU 


« 


x 






CO 

0- 




HH 


Z 3 0. 3 U CO 


U. £ CO 


0. 


S 3 


•x 


IX-)O^E_l3Q_IX 


sioj 


300 


U. u 


co 


3 


3 u. a 


cc 


t- 


h- 


CC 


Z u. 


I— 


z 


CJ 


t 





l_ 




O 


<t <t <t aa <i <r 


<I <I « 


<: 


<t <t 


a 


>x<i<i<i<i<t«<riu«<x 


<I <I « <x 


« <t <E 


<r <i 


-X 


« <t 


<I <I « 


<t 


<r 


X 


<r 


<r 


<r 


<r 


<r 


« 


<r 


<t 


c 


1-1 




z 


ill is pi <r 0- 


C *h M 


CN 


n pj 


o» 


ro ~i m if) o« — s: S3 m ss 


MTMCD 


S3 CO CS 


n x 


X 


r> r> 


<-i -1 r*) 


•H 


t> 


r> 





> 


X 


ul 


— . 


p, 


> 


< 




1 






is «r ~o is ^ 


rtH» 


<5" 


> is 





isisuorstrsuonisTcs 


0~ 0* <T tiO 


>T liO UO 


<T X 


S3 


rj 


<T -1 T 


S3 








ro 


> 


n 


X 


> 


<r 


*m 


*c 


1" 


If) 




1- 


n is <r sj >r po 


n in <r 


T 


n >o 


ri 


rscDO<rs3uo«rnisr)«r 


S3 S3 O <+ 


<r t <r 


O S3 


PI 


n t 


S3 — O 


n 


111 


111 


uO 


r 1 


-c 


— . 


ul 


CTJ 


mm 


T 


^ 


^ 




cc 


000000 


OOO 


O 








oo^oooooooo 


OOOO 


OOO 





O 





OOO 











O 














O 


O 





^£ 


1 







n -0 n h h <r 


"T -< T 


tr 


H *-) 


pi 


PI ro CS IjO U3 PJ O S3 PI S3 S3 


S3 S3 IS rs 


XXX 


0- Q 


m 


c m 


CO X 0- 


133 


cs 





O 


_ 


CK 


.-0 


3 


O 


■M 


~, 


~ 


2 




0. 


OOOOOO 


O « O 


O 


O O 


*H 


00000000000 


OOOO 


OOO 


O O 


000 


OOO 








O 





O 





■h 


r-t 


*-l 





r^j 


« 




Ul 


*4NN W 


ff -ov 


sr 


«r is 


SJ IS 


«r <r t »r 


<T f T 


S3 S3 


S3 


«r «r 


<t co «r 


S3 


T 


<r 


■T 


V 


<T 


X 


* 


V 


» 


X 


Ul 


-J 




cc 




























• 


« 





















-157- 



a.a.a.a.a.Q.a.a.tL(L&.a.a.a.a.CLa.CLa.a.Q.a.OL.a.Q.a.ck.a.CL.a.<i.a.a.b.a.CLQ.a.a.a.Q.a.a.a.a.CL.a.a.Q.{L. 
i i i i i i i i i t i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



01 

UJ 
CL 

3 
-J 

M 

«r 
u, 



NOOINOOOOOiSOOOISOCMOIsr^PIOOrsCMOONOOOOPIOOOOOOOOOOOOOOOOPIO 

~* «H «H «« PI r* T* C-J Tt CM rt CM PM 

CM CM CM CD N rs IS IS rs CM v* CM fs «* CM CM CM M P4 CM fs CM CM M PI PI PI W IS IS CM (M IS IV IS PI IV CM P4 IS PI IV IV IV IV rv PJ CM W IS 
CM **»*»*«-•«* »■• •* «« CM «-t CM CM fM»*«H »» H »4 W n f I CI « CJ «H »< rt rt h n f J »-i 



-J -1 

<£ <r 
to o 



— i i — i 

<L <Z <t 



_l _l 

<I <E 

o o 



oooooooooooooooooooo 
n © o m 

is in o 

cm cm in 



<l <z « <r <t <r <t <t <t « <t <x<r«x 

C3000C30 © CO © O O OO(0 

ooooooino PJ OOOOOOOOOOOO-hOOOOOOOOO 
co cm o o in *• o o o o *o in cm o 

o>o«om* is oin«r*H »h rs in 

iH ■« »h CO O CM IS <0 CD 00 »h CO 



X. -J* i£ -J 

cc cccc cc oc 

hl-l-l-l- 

w 

j: i: z ^ i: o 

Z ZZ Z Z r«l 

<t «<r <t <t u 

H- I- I- I- K Z 



i£k:_JiS_l_l_l_J 

ae cc oc cc a: cc cc cc 



-I -I J£ -I _! 
CC CC CC Q£ lC 



-I -I 
CC CC 



_l _l _J i£ 

cc cc cc cc 



^ o jc *: ;c ■*: 



cm -o 



ae cc cc cc 

I- I- I- I- 



•o "O >o 



»«•■# UJ uj *u i. -j -*j xj 

"' ~ - i>rt **1 t"*1 -»- -W P»n DM •» ^ -» -» M -»• ^* "»■ - 



zrozzzzzzzzMnzzzzzMMMzzMMzzzzrozzzzMirrrrj 

<t(J«<t<£«<E<E<t<IUU<I<t<E<t'<IUUU<i:C'_)U<E<r<t<£0<:'<r<E<EUUU 
l-XI-l->-r-l-i-i-l-XXu-l-r-f-t-ZZZl-u-ZZF-r-l-r-Zu-r-i-u-ZZZ 



XL 

CC 

1- 
>o >0 

Q © i£ 
tfl W Z 

u u <c 

Z Z I- 



j£ -I -I -I 
cc coca. 

I- I- h- K 

i£ © i£ iC <S 
Z 1*3 Z Z Z 

<t o <t <: <r 



inoooisooooooooooouiooooooooooooooooooocioooo^oooooooM 

CSOODOVOOOOOOOOO '-lOOO'OOOOOOOOOPiOOO'rOOfUT T U10S300000W 

(vfl-wo-HO«roooooo^ oo-o oooNOCOOxooorioo is m -oo w o © ^ pi 



no h o iii <r -o 



z 
o 
u 

05 
UJ 

to 
<t 

z 
<t 
a 

0) 

111 

■1 «*0000©00-<0©©00©©©00©OOOOOVOO©©00©©00©©©©0000©0000© 

cc 

3 

-i 
z 



pi in ** in co ■* pi o ao 

M i-l «■•, ** I*) 



O in 

PI PI 



ominmooTco in eo o coin in 

■flMtH ||1i4 <4 r* i-l -<J VIS 



z 

Id 

a 

►H 
U 

u 
< 

cc 

<t 
_J 

u 



01 

X OOOOOOOOOQOOOOOOOOOOO'*000<iOOOOOOOOO'fHOOOOOOOOOOOOOO 

I- 



«I_I_J_J_I_I_I_I-J_I_I-J_I_J_I_JJ_J_I_I_I_I_1_I_I_I_I_I_I_!_I_I_I_I_I_I_I-J_I_I_J_I_I_I_I_I_1_'_I_I 
U-rXliU,liU.Uilj,uilXrXl^U.U.liU.ljWljl.JXll.U.lXJ^ 



a 
o 
z 
z 
a 
u 



z 
o 



UlUUuitllUUUUhJUIJUIUUlllUUlUUUlUUulUulU 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

I i r I I <r ■ « a i c i i i i — i — i — i i — J i i t i i i i i i i i i i i i i i i i i — i — i — i i f i — i i i i 

oooooooooooooooooooooooooooooocoooooooaccoccoooooo 

oioioioioioioioiuiooioimoioioioioioioioioioiuoioioioioiuioioioioioioioioioioioioioioioioio^uicn 

«c«<x<t<t<£«*i<t«<ic<iC€«<£<i<r<:<i:<E<t<E<r<i:<E<t«<i<r<r<E«<t<r<E<x<i<t<r<i:<E<t<t<:<E<i<E 




z«<i<rz<rz5- 
zuu:>zxu-3 



Ui54«U«0«KT(-U«MlO>lil>Mt-<t«<tI<IJZ2UZI-IJ)-«<lOUIi:OI 

uaza.uza.zuzzuzucczuzzzzzzuuza.u.i-<i-Zu->ou.^:o.o>-<zozz 



a 
* cc 

UUI3 

a ui a 

cc JC 01 

a. u k 

t-t 3 I- 

I(£M 

oi i- a. 



u 
cc 

3 01 

x <t 

u o 

UI Z 

oi z> a 
_i I- 

_l 01 Ol 

<r <r ui 



ui 

>->z 

D-O 

21- 

M O 

<t <t z 

a t- <-* 

t-i z cc 

UI 3 CC 

Z O <t 

o z z 



ui a 

-I z 

-I <t 

•H Z _l 

>3aJ 
01 o CC 
>- I- o 
UI z z 

.£. UI K 

(_) _l 01 

O _l UI 

U <I 3 



Z 01 o 

-i a <x oi ic z cc a 

* UI UI C3 ZKUI 3 a o^ 

ZO01 CC UI Z >-< <I UI X. CC CQOUIUO 

r 3 « O Z UI Z Z u-u CC <E Z _l CC U >-UTHOZ 

cili<Ei-HOuLiii<iii.u<tiuijiiiaii:H 
i>-i- zoi_joi t-a suao j a.o 

cccccczoiuilC-izuizoiozzlC. oa_izi-i<r 

304«>IUMtXH<lMJ0MUH«(IIU 

azuoizuasuiuis-jAuiuaoiz^oioicc 



a 
cc 

3 
A 

01 UI 
CC -1 X 

ui _i <r 

h- w 3 

UJ 3 UJ 

ri. X I- 

01 _l 

H <I O 

01 Z O 



O UI 

CC _l 

_l _l UI 
ujhO J 

01 ^ I- u- 

o x en a. 

_l O >-• l-i 

a z cc x 

o i£ a 3 



OC UI 

ui cc o 

_i o cc 

I- 3 UI 

oaau 

ill Z 01 cc 

l— i >- UJ 

UI _l I- E 

:>£ 3 I- jE 

<r o ui o 

-J A CO U 



a 
z 

A 111 

3 

ui ui a 

ct- cc 

XI- ui 

01 O Z O 3 

u jh a s 

oi cc a. ui 3 

cc <r o x A 

O X <t 3 _l 

x o z i- <r 



«<t<c<i<i<r<t<E<t<i'<t<t«<r<rA<t<r<t<r<i<t<x<c<t<r<r«<t<t<r<E<r-<i<E<i<i<r<r<r<i<t«<r«<r<E<i:<r<i: 

OlllCl9■ll^co'^^-o^rtl , )^cl)■offl'^alll»^«-o<r<-ll^■MP^-<)^^o•<lM(Bl^rt^f•<)o^^^^^c^a!rtr^|<^^ 
o- pi ui pi n f> o is os eo ■* pi »h is -u >o v pj n y> ■* m m ^ ro ut v v o rv ut ^ *r o is iv pi <r ct iv m oo iv iv co v t-u ut cs th 
pi » pj t*) pi m pi o t-i n «r o -i *-• ui •-< t*i is tv o o« o pi «* n o <r -o ut iit pi oo «h pi pi pi «r oo n Iit iv >o c iv iv o r i iv co «h 
ooooooooooooooooooooooo^oooooooooooooooooooooooooo 

h ci h « rt h h ri ri ri n rt rt rt « »■ r-i rt h n iii h ri < ri ri ri M (M m n t n i<) n rt n iii h « n n ri it n <r <r mi <r 

0iHTH»H0'i-iOi-««-iiHO0OO0O'-i0000'-H0O'-<00O0O'^OO00i-t00OO00T-iO0000OO 

ir cd <r <s- <»■ t t <r ■«!■ t m «t m io is -o rn ui ui in -o ~q m o m h- in >>. ui in m iv ut ut in -a \d -o is ui rv m n m ui m r^. >a iv in 



5- 
A 

a 
ui 

i- 
cc 

a 

01 
UI 

en 

<L 
01 

a 
cc 
a 
u 
ui 
cc 



-158- 





U 


in 


a 


IN 


o 




z 


u 




o 




<x 




0- 


cc 




(0 




UJ 




cc 




3 



0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0-0.0-O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.O.CLO-O.C1, 

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

in^ininin<iinui<3Ciu^ininuiininuiuiinM3in<inuiuiuiinuiuiuiu^ 

OOOOOOOIVOOOOOrvOIVOOOOOOOOOrvOOrvOOOOOOOOOOcMCMrvCMrvivorvooo 



NWNNNNN«NP4N«NNrvNrsN^NNriNfS(SON(SI(NIONrvrvNW(\|NNJVICSiriNr4rirjrjNI^NIS 

CM -< -rt -rt -< CM C I »4 w »< CM -i CM -I N H H H H N CMCMWWWCMCMCM CM WOW 





a 


-I 






-1 _J 


-l-l -J 


-1 


-J -J 


_i _i -j 


-J -1 -1 


-1 












en 


<r 






« <t 


<I <x « 


« 


<x « 


<t <L <Z 


« 


<r <i 


<I 












_i 

UJ 


o 






e a 


CD o a 


o 


a o 


o o 


o 


o 


o o 


o 












W 


o o © o o 


© o o 


o o o 


ooo©oooooo©o 


oooinoo^ooooo 


O O O 


111 


o o in o o 


o 


o o 


© o 




CO 




ro 






o © 


o o n 


M 


O w 


o o 


o 


IV 


o rv 


o 










rv 


i- 


CM 






in o 


no m 


o 


in ro 


m w 


» 


M 


in ro 


o 










W 


z 


CM 






w CO 


•o cm in 


CM 


v4 






V 


ro rv 


•c 










Of 

UJ 


a: 


K 


_J _J * _i 


-1 


* X. 


r — ■ — r _i _J _l 


-1 -J 


Jit -1 -J -1 -I -1 


vC ■* -1 


j; 


JJ1C 




-1 i£ 








a 


z 


cc 


CC.CL.CCCi. 


cc 


cc cc 


cccccc cc cc cc 


cc cc 


a: cc cccccccccc 


cc ce at 


CC 


cc cc cc 




CC CC 








r 


W 


H- 


\- 1- 1- 1- 


K 


t- h- 


hl-h H K t- 


Y- 1- 


l-l- 1- K 


h- H H 


hhH 


H 


y- k i- 




1- 1- 








hi 


<r 




<0 


SJ <0 


O 


o -o -o in -o -o 


in -o 


>0 








in -o 


-o 




•a 


>0 




U 


1- 


K 


•o *. jC *. *: 


n o o 


^ JC o 


ZZZOOZOZO/OO 


KiCOO 


id V£ <3 V£ V< 


tcicx. 


it iC iC 


i: 


* jc -^ o o 


o 


^ iC 


o 


o 




UJ 


Z 


z 


ro z z z z 


z ro ro 


z z m 


zzzioMZPiznznii 


zznn 


z z n z z 


-z.-z.-z. 


Z 2 Z 


2 


z z z ro ro 


ro 


2 Z 


10 


ro 




a 


O 


1 


u <r <r <t <r 


«uu 


<z <r cj 


<r<i«uu<iu<cu<xuu 


(CUD 


<E <t U <X « 


<t <I « 


<r <s « 


<r 


« « <E U CJ 


CJ 


<z « 


u 


CJ 




3 
CC 


CJ 


1- 


Z h- K 1- 1- 


i- r z 


hl-I 


i-i-f-zzi-rt-zt-zr 


K i- r z 


K 1- Z 1- K 


1- 1- K 


h- 1- H 


H 


1- 1- 1- z z 


r 


1- K 


z z 




CO 


o o o o o o 


o o o 


o o o 


OOOOO©OOOO©-0 


o o o in 


00 O O O CM 


o o o 


ui o o 


O 


ooooo 


o 


o o 


o 


© 




X 


UJ 


o 


O O O O O 


o 


o © 


ooooo Noooon 


w O CM 


T O UI O UI 


UI UI o 


M O 


O 


ooooo 




o © 




o 




K 


cs 


o 


o o o o © 


o 


© o 


oooom ouioom 


o o 


rl<-OI/)« 


to -i O 


rv o 


o 


Ml CO O ll* O 




o- o 




o 




tO 


IO 


O O Mil 1") 


00 


ro in 


inoooocM rv-o-oncM 


o 


-O CM O CM 


v* CD 


w Ul 


o 


HOTU1N 




o o 




Ul 




OK 
W 


a 




in cm * cj *• 




*• 


w w < m in r» 


V 


M 




rv 


Ul 


CM CM O 




-t CM 




Ul 




> 
-J 

3 

o 

z 

l-l 

cc 

3 

a 

(0 

1- 
Z 
UJ 

Q 

M 

u 
u 

« 

cc 
<t 

-j 

3 
CJ 


CO 
UJ 

M 

fit 

3 
"J 
Z 

W 

CO 

X 

1- 
<t 

UJ 

a 

CO 
CO 

<r 

-J 
u 


o 


ooooo 


o o o 


o o o 


oooooooooooo 


o o o o 


o o -• o o 


o o o 


o -< o 


o 


OOOOO 


o 


o o 


o © 




o 


O O O O w 


o o © 


^ o o 


OOOOOOOOOwOO 


o o o o 


oooooooooooo 


o O O -i o o 


o o 


o © 




u. 


— 1 — 1 — I 1 1 f J I 1 I 1 1 1 1 1 1 1 1 1 1 1 1 1 J 1 I 1 1 1 1 I 1 I 1^ 1 1 1 1 1 l_J I I 1 I 1 I t 




u. u. u. u. u. 


U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 


U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 


u. 


u. u. 


u. 


Li. 




M 

X 

u 

■> 

a 

z 


> 
i- 

a 
o 
r 
r 


UJ 


Ill III ill 111 III 


UJ UJ Ui 


UJ UJ UJ 


UJUJUJUJUJUJUJUJUJUJUJUJUJUJUJUJ 


UJ UI UJ UJ UI 


UJ UJ UJ UJ UJ UJ UJ 


UJ UJ UJ UJ UJ 


UJ 


Ui Ul 


Ui 


UJ 


m 

LU 

a 


M 

3 
-1 


o 
o 


z 


Z Z Z Z z 


z z z 


z z z 


zzzzzzzzzzzz 


zzzzzzzzz 


z z z z z z 


2 


Z Z Z 2 2 


2 


z z z 


z 


o 
u 


_1 


1 1 1 1 1 


_l _1 _l 


J — J — 1 


1 1 1 1 1 1 t 1 I 1 I ! 


_J _l -1 _l 


-I _l -1 -I _l 


1 1 I 


i i i 


_l 


-1 _J -J -1 -1 


| 


1 _i 


_1 


_J 


o 




o 


o o a o o 


o o o o o a 


oooooooooooo 


o o o o 


ooooo 


o o o 


o o o 


c 


OOOOO 


O 


o o 


a 


o 


> 


3 




en 


en in en en en 


in en en en en en 


C/icncnuicncnenenenenenin 


en en en en 


in in en en in 


en en en 


in in en 


in 


in en en in en 


Cfl 


en en 


en 


en 


1- 


z 




<I 


<r <r <r <r <i 


« « « 


<L <L <Z 


<i<E<r<i<r«<z<r<i<t<t<r 


<t « <r <t 


<t <t <E <E <E 


« « <n 


<l <z <z <r 


« <t « <x <t 


<r 


<t c 


c 


<r 


— I 


l-l 




o 


BOOOQ 


SCO 


13 a a 


oooooooooooo 


o o o o 


OOOOO 


CD CD O CD CD CD 


a 


ooooo 


O 


o o 


CD 


o 


o 

z 


CO 




W 


<oa>in<H4 


IV T ~0 


•H »< M 


in n o »"0 n * > o in »< ♦ 


vMon 


OHH^OCh 


in v w 


ro n rv 


io cm m rv o o 


^ o ui in mj 


1- 




cm 


Of4v1*4H 


w CM CM 


WOO 


HHOOrt^NNNO-tO 


w w CM O 


w CM w w O 


O O w 


O CM CJ 


CM 


-i —i -i O CI 


o 


CJ © 


o 


© 


z 


z 


UJ 


V 


•SV S. S X 


V. V. V 


V V V 


NNVN"VVVNVVV.V. 


ssss 


•v \ v. v S 


X V V 


V N v. 


V 


V V V V V 


V 


v, v 


V 


v. 


o 


u 


t- 


-o 


w ro «r * *■ 


IO «T <T 


CMwioinininLiincjiiiwm-oin-o 


•0 <0 -0 CM 


^ O CO HD rv 


IV *H M 


cm rv rv 


CO 


C J ffl CM ffl CD 


CM 


CO OS 


Cn 


O 


CJ 


a 


« 


o 


w © o o © 


o © o 


o o o 


OOOOOOOOOOOO 


O oo o 


OOOOO 


o o o 


ooooooeoo 


-* 


© © 


o 


o 




►H 


a 


N 


V, V. "V v V 


V V. V 


V V V 


VV.v.vvv.\v,VV.v.V 


•v V V V 


V -v "v v. v. 


V V V 


V V V. 


V 


V N V. V V 


V 


v "v 


V 


\ 


a 


u 




M] 


ro in m ui in 


iii ui iii rv is ol 


iii ui in in ui -o ui rv m « «o in 


in in in rv 


in >o vj m ui 


n ui rv 


rv ui in 


<0 


n ui rv in ui 


-c 


Ul Ul 


Ul 


in 


z 


z 




rv 


n r« rv rv rv 


rv iv rv 


rv rv iv 


rvrvrvivrvNivivrvrvrvrv 


rv rv rv rv 


rv rv rv rv rv 


rv rv iv 


rv rv rv 


iv 


rv rv rv rv rv 


rv 


rv rv 


IV 


rv 


<I 


z 


OS 


<E <C <E N en 


JX<>-««0<«(JI-X<OBIII«lD<<lllBt? 


<t CC _i 


x « « <r 


w O -J >• o 


_i 


—i a 


Ci 


> 


en 




o 

M 

1- 

<r 

CJ 


O CJO 0. 41 


wko.*:_jzz3cjowz>-cjxzocjo.zcjci.cjxwo3 


o O M 


h- CJ O CJ 


Z CJ <I Z CJ 


H 


X i-i 


— 1 


3 


en 








« 




3 

u 


> 












3£ 








u 




o 






M 




a m 


LC UJ 






aa 






CC 








>• 




_i 






XIU 

LJJ 


-1 CC X 3 UJ 

uj i uj a u -J 


X ecu 
o ui z 


-j 


ft. 


_i_j 

UUI 




3 UJ 


4 

CL 








a 




»- 


a 




-J 


-1 -i 


MM3IZ <r Z _J UJ 


l£ Lu « 


3 


z 


M M 


UJ 


UJ o z 




3 




U 


a 




z 


z 


CO X 


O UJ 


M UJ 


U.MO«<t UJUJM<-1 _| 


3 X 


<r o > a 


<c « 


U. U. 


CO 


a w 3 o 


CC 


_l Z Z 


H- 


LU 




UJ 


<i 


« Z wO 


OOO^flZ 


OZ-JZ-I ZS<I33<I 


* UJ U 


mc i- uj 


Huoineoeo 


o 


>- O 3 « 1- 


U. 


3 CC 


_; 


1- 


— 




a 


_i 


Z O > Z _l 


«Z<I 


WmO 


ZOixZ^ZU i-woa 


en -i x 


_i <r uj m cc 


z z 


a cc cc 


-1 


UJ O 01 L. I 


Z> 


-1 3 


3 


UJ 


CC 




M 


M- 


w in cc uj ui 


CJ l-i _J 


a: _i t— 


MZjcu<ijozyuz 


►- »- 1- i- 


<L U i-i 2 C 


O 1- o 


JU1J 




Z 3 1- 0. O 


C 


o a 


B 


J 


o 




U 


OS 


JKOCOu. 


w > w 


uj en 3 


oo-j^ociCHZs^ciiuii-i-enH 


en en cc 3 z 


> »• -1 


CC )C *. 


z 


Z CC H 3 i-i 


z 


Z V 


> 


_J 


en 




z 


o 


<t <r o x 3 


x cc x ■*. uj 


i^iiiCi-oaooMO j 


MM«r 


W <t M O 


coa 


a « •« 


a 


o a >-> <z cc 


<I 


O UJ 


LU 


w 




o 

CD 


H4 


Ol 


en o a a. h 


uwo.«ujzwioaeniou«_iXLuxocu_i_iw3Cvo:3x_iaacja«cnc£ZO.x»xxxxo 


UJ 


o 


<t 


<t <r « <r <t 


« « <t 


<r <t <t 


<i<r<i<i<i<i<i<r<i<r<i<i 


<x <t <t <I 


« « <r « <r 


<x <r <r 


t«SJ« 


<z <z <t <x <r 


<r 


<z <r 


aa 


« 


« 


W 


z 


CD 


n r i -o n co 


CJ © M 


cm t* »r 


o»*f<ooc»N'OfHno'rt 


IV t> CJ >0 


ui cs o ui ra 


TOO 


ro ui ui 


CD 


ro o w ui w 


Ul 


rv ui 


Ul 


>c 




1 




•c 


q- CO <r o o 


O CO h 


mo4 


nuirvCM»H(B«r^-^cMMCM 


O 0v CM «0 


Ul 0» O 0s in 


m in «• 


10 Ul Ul 


S3 


CM CI O CD O 


MD 


V Ul 


LI 


Ul 


in 


in 


H 


•T 


I'INIIK'O 


NO* 


o cm in 


•orvrvooo»-i©>-to«!"o-o 


N O O CM 


OO0> UN 


<r «r o 


C* r-i — t 


w 


rv C* 0* O* (► 


T 


ro «• 


<T 


Ul 


a 


w 


o: 


o 


© © o o © 


o o © 


o o o 


oooooooooooo 


O O w O 


O «h o o o 


O O rt 


o o o 


o 


OOOOO 


o 


o © 


O 


o 


cc 


1 


o 


CM 


w * vr t *r 


«r in m ro w ui 


ui ui ui ui *o « yj cm >o >o in <o 


■0 «0 «0 CM 


iv ok oo rv rv 


IV CM M CM 00 00 


0> 


CJ CO r 1 CD CD 


PM 


o- o 


o 


> 


o 


z 


0. 


o 


W © O O © 


o o o 


o o o 


ooooooooooooooooooooo 


O O O O O O 


o 


ooooo 


w4 


o © o 


o 


u 


<r 


UJ 


IS w 


•a in 


UJ 


T 


CC 


















• • 








• 


• 




cc 



-159- 



«0 
M 

u 

a 
<t 
a. 



a 
o 



a.a.a.a.a.a.a.(La.a.a.Q.a.a.CLa.a.a.a.a.a.Q.a.a.Q.a.a.a.a.a.a.a.a.a.a.a.a.a.Q.a.a.a.o.a.a.a.£i.a.a.a. 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxzxxxxxxxxxxxxxxxxxxxx 



©©©©ooMeorsooooooeoMOOoooMooooooooooocoooooMMoo©— ©o 

N — MM (MM 

N N M N M N r^ M N »h M r*. N P» (S N M N M N M rv M N M M M M M M M N M M r>. M M M M M M r» M M N M M »< M th 

— — m — ri — — r j — — h m « ^ « n h « m h n h mmmm m — m — m m m m m m — — mm m — 



-i _i 
a a 



(3 






c 

3 



-I 
U 



-I 

a 



jjjjj 
<r « « « <r 

O Q (3 (9 (9 






-i 
a 



_i _j _i _i 
<x<r « « 
uooa 



<x <t 



_i _i _i 

<t <x « 

QOD 



O©tnO©©O©O©OO(n©©©OOOOOO©©©OO©OOOOOOOa0©O«r©©©©©©OMOMO 
IS M O M — OOOOlillrtOOOO — © > © O O O M 10 W 

— © — int«icDifl>o»oioiof!in o o* «r m is in -o o- 

» CD * *MM* - M(D0>— MOO M V MOB ^ rs 



_i -Ji: -j ii _i_i 

hhhHh I- K 



_l *_l * ii 

Ct Ct OS Q£ 0! 

I- H- H- h- I- 



_l 




_l 




ii 




* -1 


a. 




GC 




k 




£ IX 


K 


«0 


H- 


-0 


K 


■0 


t- K- 



I I I I ii ii ii -I ii 

CC Ci Li Ci <x ic cc cc cc 

hhl-l- (- H- H- ,,H »- 
■C UT »0 ~ - Hi «0 «0 



_l ii _J -I -I 

a: ci ii ws oe 
i- i- i- i- 



zzzzzmzzmmzmzzzmmzmzmzmzmzmzzmzzzzmzzzmzzmmmzzzzmz 
««««<:u<E«uu<i(j'««<iou<rU'«u«u<tocu<E«u<t<t<i«u<r<:<tu-«<ruuu<i<E<:<Ec;<E 
hhwhi-xhwxxi-xht-hxxi-XHZHXHXHZhr-xi-i-i-i-xi-i-i-xi-t-xxxt-t-i-i-x*- 



© oo* © o© 

o o — © -o o _ 



O0LO©03©inOO©©©O©OOO©©OOO©©OO©MM©O©O©O 

onooiio«ooon<fo*oon o © o o oo o n-o ootio 

o o* © o — o n OS O M IV OOM OOOOs OUT OO— O © M IO 

IO M O M M — — © M C *■ 00 M W © UT M © M © — V — «r — 

N m -0 — — M -i — IO IS M fi Wrt M 



OOOOTOOOOO 

~OOUTMO©0© 
MOM l> UT lO O 



— in — M in IO M O M M 

— — *■ in n in -0 — — 



M IV M O 



ii O O O O O O — 0©0000©OeO©0©0©0©0©MOOOOO — ©oooo©oo©omoo©©— o 



O O O — 00©0— ©00©00©000000©000 — OO — 000000©0©000©00©©0©0 



UJ 

a 

—I 

u 
u 

« 

3 

u 



en 
en 
c 
_l 
u 



— i_i_ j i — i i i i_j i^ i _i i_i i r i i i i i i i^ i i i t_j i i i i i i i__i i i [^ i i i i i i i i 

U.U.LLU-LvLuU.LL,U.LkLuliULuU.U.LL|j.U.U.LLU.LLLLluU.LLLuU^ 



I 

z 
« 
-> 



o 

us 
as 



UlWUJLJUJLJUJW'jJLULULJLULJLdLLlUJUJLdLULUllJbJ 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

I I l_J I I I J I I I I ! I I I I I 1 ! J 1 !_J I I i_j I r ! i i ( I I j i__i t i I i 1_J i l_j I 1 

oooooooooooooooaooooooooooooocoaoooaoococoococooco 
uinuiaiutiiiouiviintninuoiniriiooiiiiioiANnoitfltflininntiiiniooixiDnioiiioioio^nn^^aiuiistn 
<t<««<t<t«<t«<i<i<t«c<i<t<i<i«<tc<t<i<i<r<t<r<i<E<i<t<i<r<i<t<r-«<r«<:<E<i<r'«<s<r«<:<ic 

O0(3(3tDOO0OQOt3OCDOQOO[DQQGO'J0OC3O0£DC3Ot3OCDOt3OO0C33OOCJi300t3O 



© — MO— 00 M — O- 

M M — — — O — — M 

S. S, S. S. S, S. S, S. S. 

O O IO O M O N M O 

— — o — o — © © — 

S. S. S. S. S. S, S. S. S. 

MM-OMfvm r--rsio 

N NN N NN rs fs rs 
h«5 JMX jwa 

I33ii.ii- <z x x 



q- 


IS 


o 


r-j 


s 


N 


^* 


o 


— 


— 


s 


\ 


in 


111 


IS 


IS 



r u. 



0» — ■OWVM-OlS-O- mmm 

— M M N O M — — — M O M — 
N.s.s.s.s.s.s.s.s.s.s.s.s. 

— M — — M M — -0 — M M M M 

— o— — — © — O — o— o — 
s.s.s.s.s.s.s.s.s.s.s.s.s. 

in m ui in m rs m -o ut rs m is m 
rsrsisisisisrsrsisrsrsrsN 

h««J«KK«Ci:>-C5KI- 

3:3H.33«I«3I3U3 



— 03IS&.>OOMMOB«OIS— <0— — OtV0^MOOCVI>— MU"! 

— M— — — M — O— O— MMOOMOM — — — OM— — O 
s.s.s.s.s.s.s.s.s.s.s.s.vs.s.s.s.s.s.vvs.s.s.s^s. 

— — M — M t>- O IS O 03 O- — — M M — M 00 — «T OB — M M M »• 
OOOO — O — OOOOOOOCOOOOOOOC— OO 
s.s.s.s.s.vs.s.s.s.s.s.s.s.s.s.s.s.s.s.vs.s^s.vs. 
•C(SN>OOM~OMIjTMM-0>0-0<!-0'OM-OUTM<IISUT-CM 

rsisisisrsisfsisrsfsisisrsrsrsisfsisisistsfsrsisisis 
<t<ii>_i5-x_i—x_i<t«0iii:ii:o>-<r^>_iii:i£<ixa 

UZ«Zhli.ri-li.33«OOH3J3ZHO«Uhll) 



Z Q 

CD — <S 

o uj z u 

z _i uj »- 
>-• t- a cn 

JHZU 
_) « UJ X 

— U _l o 

amui 



— z 

o<-> 

!£. -I 

K- _J 
UJ UJ 

O 3 



-I 
-I 

ZhH 

<r — i 
r o 

JKZ 
-I I- o 
D UJ X 

U uj O 



X Lt "I 

G <th 
— 3 Z 

CCh« 

3 cn r 



Q 

a z 

Z 3 

o o 
r r « 

z z 
u a 3 

— Z <Z 

ce <t r 

cc — 
en a 3 



a > 

o ja>- ££ 

UJ O UJ O UJ 3 

OhCIO A 



3- 

a \- 

O JHU 

CELIUZ 

a 3 m >- 
cc a u. cc <z ijc 

O 01 Ui LU ii. LU Z 



^ i_^ ■■— ~ l_> gj wu i_j w> uj jj lu, uj 

ht3li.3ZlD4L.ZiLu X — 
hZZZZ^n 2h-LUUJ_JI-UI- 
<tt3UJZlLlUJ_JOL£_J ^3i JOl 
U<: J>J3C«« JCOQU3 

into jooinnuaaii** 



UJ 

UJ 

en 

<t 
x 
<r j- 

_j -J 
-i -i 
<x o 
I- x 



3> 

o z 
c o 
<i in 

_J ii 



LJ 



Zl- 

— 
I- u 
3 

z z 

— o 

_; h- 

01 2 
3 LU 

i a a 



UJ 

z 

>-h on en 

3 c a 

lj z z 

« j; Li 

Li li. LL. 

a en ra 



a: 

UJ 

3 

Lt Li 

3 > 

a z uj 

I- UJ _l 

z uj a 
O ct — 
z a en 



ii 

Li 

a 

LL. Li 

X LU Li LU 

K ii LU t- 

Li U X X 

a a o lu 

z _i x a 



H c 
Ci — 

■x a 
Z X z 

3 3 0£ 

I- « _l LU 
MKOH- 
3ZU91 

3 <r 3 
x en 3 u 



«««««4«4«4 4«««««««««a«a«4<i««<rc'i««<i«a««fi<i«4<r<t<:N«<i«« 

M -0 M f-J -O — OC*-ffi«TMISOO>0CDIS < ! - ^a3OOIS-O00l>-ri — CDIS>00^CS>— OlSO-tS^COMOOrSTOOrsM — 

>om— — rsijTo^m^ooo^Tyjrsrsri— orjrsr-jo — M'C-oa — rs rs o m oo m is o ut — — m — «rM«r — escv— cm 

— — is«risisrsisMin-ooo»— — n— Mfl-fr-jin — isuttoiso- yj in ui o <r m m m m m t m ui >o m ii~ «o ob rs — 
oooooooooooooooo— ooooo — ooo — oooooooooocoooooooooooo 

— — in O M O M M — — — — M M M M M M IS f J <T M M M — M M — — O O IS <r O 0- M M M M M M CS M M 0> CM ^ «* M ff- 

— — O — O— OO— — — — O— — — O — O— O— O — OOOOO — — CO— OOOOOOOOOOOOOOOO 

MM-oMisuTrsrsnnu'ju-)fs(nuTiinis«-oii-)rsmrsi(-j-oisrs>oisM>OMfsMM-<j-«y3<o-o-oM-orsMs3rsN<M 



en 

UJ 



c 



c 

X 



c 



s 

LU 
H- 
S£ 

3 
0". 

L. : 

Li 

<z 



-160- 



0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 

■o in ■« in n in in -o »m in in - w<inMjui«inin<ininin^oinurinintninin>offlinwin<inininvininininininin 



UJ 

cc 

3 



OCMCMOOOOOOOOOOrsCMOOOOOOOOOCMOOOOOOOOOOOCMOOOOOOOrJOrMCMOO 
(MM r* CM (M CM CM CM CM 

CM M CM IS rs CM CM CM CM CM N CM CM CM CM CM PJ CM N CM PJ CM CM CM CM CM CM CM CM CM PJ CM CM CM CM CM W CM PJ CM D CM CM CM f M CM CM (N CM PI 
(N ** -« CM PJ CM CM CM »H PM PJ CM CM ~* CM CM CM CM M CM CM CM CM CM CM CM CM CM CM PJ »< CM CM PJ PJ PJ PJ CM CM N 



<r 

Z 

o 
(J 

en 

UJ 
CD 

<r 
x 
<x 

a 

en 

ui 



<x <r <t 

ooo 

o o o o © 

O OCM 

© © ~4 

CD T CD 



i ( i r i 

« « <r <t « 

CD CD CD CD CD 



_l _l 

<t <r 

CD a 



CD 



J -I 

<r <r 

a CD 



— i — i — i — r i — r r i i — ; — i i — f — i i f f i j j i i i i ) r : i ( ( 

«««<r««««««««<r«<t<x<E<t««<i<i<i<r«<x<i<i<i<x« 

I30000I30I3000000UDOOUOOOQOOOOOOOO 

oonoo^oooo^-oooooo 

^S ^.l ^ ^ ^ i~* o^ Q 

«0 



mcMOOoooooooomoooooooooooocomooonoo^oooo^-ooooo 

cd -o m m o o o o oooooooooofflrHD'OiiToriofinnooofiocooo 

■o o~ rv <i »• © M w-oo»Nvoo©f"50 •-! n cd -o o -o »- in in «h w pi o to m in c m o- in 

•C V CD «■♦ * CD M PJ ^ O M CM -O x * »< ^- ^- ,-1 «H 0» ,-iw^-w^ 



-I -I 
a: a: 
h »- 
«o 

* *: © 
2 2f) 

t- f-r 



-I Ki j en ^ _i * Jt * _l * _l _l * ii _i ^ — i — p — i -J .j * _j ^ _i -jc _i 

a: cc ce cc _i os cc cc ccclu.cc cc ecu. cc cc cc cc cc cc <c cc cc as cc cc cc cc 

I- hl-h 0-t-t- K ►- h- h- h- t- ►- h- I- hi- h- t- I- hi- V-h- I- h-l-H- 

•o «o >o >o -o in -o <o<o -o <o -o »o -o in -o -o -o • 

2M222n222Mr)l«5M2M2222r52M22M2Pr)22r0222M22r)m22M2r>onzZ2 

Kii-hi-rji-i-tttii-ri-hhi-ii-ii-i-ri-ri-i-ii-i-i-ri-i-r- 



_ o <e <r <i 

XI-h-XI-XXI-H-h- 



o©©ow©in©©oooooo©©inoo©ooooo©oo[soo©oooin©ooo©o©©o©o©© 
ooooonnooo'CO © •oopjoooo© o o *• © w o o© w ©o out© ooin 

©Oi-tov cm m o o v «4 © mo oncooo on «o in oo »<o © «-• ^- is »r rs 



© CM CD OB »H 

© in »< w 



O © © «H V T* 

in ~ rs n 



in 


HNI<) 


O »H 


M 


CM 


o 

CM 



in « 

<r OB 



M 0000»<0©00^000©»<000000000©000000©0©0000W. 0000©000©00 

cc 

3 

-J 



CMOO©©000©©00000000©00-*000000000©000©0000©0»<0©©0©©© 



— I — ( — l — i — ! — I I I — i I I — i I I — I — t — i — r — i — i — i — i — ( — » — r — i — i — i — i — ) — / — I — I — i — I — I — i — i i — i — j — I I — i i — i — i ; — i — ; 

U.li.U.U.U.b.U.U.Ii.U.li.b.U.LLli.U.U.Ii.U.li.U.U.U.lvU.U.lLU.U.U.I^U.U.U.U.li.Q.U.U.1^ 



UJUJUJLJUJUJUJUJUJlULULUUUJLJUJWUJUJUJLJldlULULJliJUJldW 
22222ZZ22ZZZZZZZZZZZZZZZZZZZZ2ZZZZZZZZZZZZ222ZZZZZ 

1 — I I l f ( I i i 1 I i i i i i — I — i — I i I I r t i r ; i i i i ; I : i i i i i : i i F : i — ; — ; — i — ; — i 

oaoooaoaooooooaooooaaoooaaooocooooooaooooooaoocooa 

cocnwcocncnajcncocncncncncncncncncncncncntncncncncntncncncncncncninmcncncncncncncnw 

<x<t<t««««<E<t«<t<t<t<t««<t<i<t<r<t<r<t<t<c<t<E<i<t«<r<t<r<E<i<t<t<t<t<t<i<t<£<t<r<i<r<r<r<r 

OOC3000000C9000aOC3(SOOOOOOOC9QO(SC3(3000000000C3UOaOC3C30000 

OBOOM^oBinuiOK^CMrscM^*-ooB-<'Hino©»<oB^OBOMOBUT>ouT^rs-oinos»H«iiTniv»-»rN-«c>-'<rioc>4 

rtrtOrtHOOrtftoHrtPirtONMOrtM'i-MNrtor'iKononooPtoNHHHrtOonrjO'Hrjrt 

N.S.S.S.VS.VS.S.S.SSS.S.S.XVVSS.SS.'SVNVS.S.SsS.S.N'S'SSS^v.S.S.XSS.S.S.VSSS.SV 

*• «. ^. «. ~, -. w. ... _ ~. ^ ,~ _« .» „ — ..., m ^ ^ *. ,., -. q — ,„ .q q^ qj (., a .Q ^, n N ^ f g N N Q3 ^. ^ r . t Cl rJ gj qk Q^ 

Wv4^000©thOO©0>40i-it4ihOOO^<-ii-iOOO 

oBCDrvrsNrsoBrvrsrsisrsrNrsrsrsrsivosinf^cacDCBrv 
i».rsrsfvtvrvpsNisivrvrNNisisr».rvNNNisNis(s.rs 



2 zjHhii)<>-(iiHH«<(zo<iouooi:«<x>aHHU(i)(iix)-«4N^>^HC«z^>i-iiii->«« en 
O x u. c x ^ r> i£ x. £ s: o u r u r r z r r <t u cd t- x. en e r z r <i t- *. u u <s >i z <r r r u >- 3 z u x. iz z a. > in 



u 

-J 
« 
a 

ut- 

-I O 2 
Z) 3 <t 

<i <r _i 

U. JM 

(0 

t- t- o. 
co u. v 



UJ x 

JU 

-ice 

•h 3 

> X 
2U 

-I 
z o en 
o CJ _i 



cc 

« 
ae a. 
ui 
i- © 

inzi- 

UI<IM 

IJO 

o cc cc 

2 UI h- 

<r r> bj 
x o a 



t- 2 

h-H UJ 

o u 

cc: en z 

i- lu <t 

UJ cc o 

DU J 



U UJ 

ui o a a -i 

o: cc -j cc <x o ujuj 

I- OS 3UI© uiZ J J 

Z UI SHLJiid CC O O _l_l 

UI t- ZCDlL JIJHZ <t OCQh- Ml-iO 

U (ft«OZOI-5ZOZO)ZL.MUI35DT 
iCklil-UZI-OC^OOOCCZJdinZU 
^<:UOZCCHHJ^U10ZI-UJUJh.U.hUJ 
2ZlClCUlCCC_JU_I3ZCC2H- UJ.h- OZUJ 
<IOODuCit >OOUD<lLCUJJDiCC 

enuj3<rui3cnzzcnx_ixu.3c3Z<ixc3r> 



2 0£ 

UJ UJ 

:> k 

« <t 

X X 2 3 

CC i-i O CD 

UI 2 K 2 

k- ui cn m 

2 a 3 cc 
m x o a. 

3 4.101 



U) 3 

t- O 
UZK 

cd cn 

« 2 X 

CC o « 

oin h 
x w _i 
u a _i 
2 <i w 

« X 3 



a 
cc 

a a 

ui _l _l 

X 2 UJ _l 

I- UJ >■ U. 3 

Z _l _l 2 X 
DIUUO 

O <E X -J CC 

X X U CD U 




en 

CD 
u. 

in 
-J o 

a _i « a a 

Z«3JZ 

<i x a a <r 

j Ull J J 
CC H- CD X X 

UmDDO 

o 3 o- a x 

<r <z <r <i <r 

<r -• T o o* 

«■ ro I s - v N 

n n n -< n 

O O w o — 
»H CJ CO -h o 
© rt © « O 

oo a a a is 



-161- 



Id 

CD O 

CM O 

r 
u 

(9 

<t 

0. CC 



^a.a.a.a.a.te.fl.Q.o.a.a.fl.a.a.a.a.a.a.a.a.Q.a.a.Q.fl.Q.a.a.fl.Q.CLa.a.a.o-fl-Q.ii.CLfl.a.a.a.u.a.tLCLii. 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
zzxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

ininin<uiinininin<ininininin>oinintnM3inwininininMjinintninuTinininin^^>on 



000000OOOCMOCMO000OOO00OOOCM00O0OCM0OOOOOCMOOOO0OOOO0OO 
CM CM (M CM CM 

CM (M CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM «« CM CM CM f 1 CM PI M CM CM CM P-l CM CM CM CM CM CM CM M 
CM CM CM CM CM CM C-l CM CM CM CM CM CM CM CM CM CM CM CM CM CM f * CM CM CM CM CM ~ CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM 



(0 

-I 

u 
cc 

CO 

rs h 
c*> r 

~ « 

fit 

Ul cc 

a z 

r -i 

Id <t 
U I- 

uj z 

Q O 

u 

3 

Of (ft 

X Id 

K CD 

i«i r 
n « 

c* a 

01 

> UJ 



i i^ i i i i i i i i i i i i i i i i i i i i i i i i i^ i i i i i i i i i i i i i i i i t i i i i 

«««««««a<t«'«««<r«<r<t'<i<t<i«<i<E<i<t<r<r<r<E«<r<t<i<:<t«<r<r«<i<E<i<r<i<i<E<i<t«« 

OOOOOOOOOOGDOQOOOOOOOQOOOOOOOGQUOOODODOGOODOOOIDOOO 

©OOOOWOOinOOO^O 

O O O (B CI 111 •< C fi O O O T 
0>THOO-C(MO-QOON 
IS -O »n-rt^ Nffl»NO- V 




-I -I 
CCCC 

I- h- 

-0 

r«l Z Z 

u <z <r 



cc cc 

I- h- 

•o 

© ^ *: 
f> z z 

U <KE 

rt-t- 



_l X *. _l _l 

cc ce cc cc a: 

I- I- K I- H 

>0 -O NN 






ce.se.ce. 



cc cc 

t- i- 



cc cc 



cc cc cc 



cc 



•O <l -0 



*o ^o ^o >o *o 



ZMZZMZznnzMZMMzzznzznrnzznzninmzzzMPOZMMMz 

«u<n«u«<iuU'tu<ruij«ccu<r<tucj<r.«ucij<->u<r«cuu<:uuuc 

l-Zr-l-ZI-l-ZZI-Zp-XXI-r-l-Zr-l-ZZI-l-XI-ZZZI-l-i-ZZI-ZXXI- 



-I 
ae 

t- 

SD >0 O O 

© O © © iC 

!*! M M M Z 

O U U U <t 

Z Z Z Z »- 



Oir>00>000©0©000000<000000'9-©00©©©OISOOCBOW©©©0©©©©0©0©©© 

o Cf- cmo oooommoo cmoooootoooooot ©ori-oo-oeo© oooocoooo 

o w -o m oooo^oMinm rt^troooooocooo© rHinm^^ooosi iiimpjooo-ooo 



»« is o in 



■O W <■ m CM 
CM »n CM 



v •< cm iii w is cm m © ** o o ■«• 



© O O »h 
© o -< 



» H O o n M < B 



3 cc 

-> z 
-> 

a z 

z •-• 

CC (ft 

3 Z 

a »- 

CO Id 

t- a 

z 

Id 

a eft 

<-> en 

o <t 

U -I 

« o 

cc 

« 
_l 

3 

u 

w >- 

Z t- 

UJ M 

3 a 

o 

o z 

z z 

►H O 

5 u 

-I 
o 

3 



•i 00©00©000©00©OO^OOOOOOOOOOOOOOOOOOOOCMOO©0^00'H'rH©©©0 



O©0<~0O0OOT4OOO0©00O0<i-tOOOO00<'4OO0O0OO0OOOO0OOO©*4OOO©O 



! — I — I — I — i I _J «_l 1 I I i _J ( I I — T J I I I — I __J I ( I I I I I I I I I I I I I _J I __i ! ! ■" I I ! I f i 

U.U.U.U.U.U.Il.lj.U..j.lLlJ.U.U.U.lJ.U.U.U.U.U.U.U.li.lj.li.lJ.U.lJ.U.U.U^ 



UlUldldUlUIUIWlilldUiUJIdldUlldUJUJUiUitdUlljJUJUJUJtjdUlUllilUUlUJlJdUUiUlLUU 

zzzzzzzzz zzz z zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz zz 




z 

UJ 

a 

u 

z 

o •* 

CO 

o- o 

~ z 
I 

in i- 



00 >0-0 

CM MO 

s, N S. 

eg in — 

« oo 

v. \ s. 

IV is CO 

rs rs rs 

o >■ <z 

z sc u 



co n cm 

h Oh 
s. s. s. 
CD — >0 
O © O 

V % S. 

is CO lrt 

rs rs is 

m cc a 

z o z 



Id 

3 
O 

a cc 

OJO 
« I- O Id Z 
M ul Id »■* Id Id 

aoiHU. ou 
z cc a z <t a 
3 ui >- »- cc 

JIZ3I-U 

o o <r o o a 

O W CO Ift u « 



-O -0 ov 

CM -* © 

V s. s. 

m eo -o 

o o o 

s. s. N 

IS CD CD 

is is is 

>- <Z<t 

z ua 



ui <t 

_j >- 

K « h- 

ui a ui 

3 z w 

z uj cc 

■x _i <r 

z ca r 



TNNO.ooiiiwno.^MNMBNO'Oconco-ocov'flrtcoonN'fN^cMiincofr'Hii-, o 
o •< n o m cici o -< h o o •< o h « n •< c i n « o o n r-i r i •< n ri m « o ^ a o n »< n -i o r-i 

S.S.VS.VS.S.-VS.VVVS.S.S.VS.S.VVS.S.-vVNXVSxV'SS.S.S^VVNVS.VSS. 

»»uT>rtUTiji«OM»<'-<0'>-<o-ciocifoincifiCDmMnNisor<,rr!Oso»'rtrscocDfl - <rN«r>offl 
OOOOOOOOO^h«00-hOOOOOOOOOOO^OOOO— ooooooooo 

Ss'SS.V.V'SSS.VSS.S,VS.S v %^X\VS.\S.\\> v S.S 1 > s - s \N v \V.S.\S.x.XS.S. 

Q0(SCOa^r^rsCDCDCD03QrvCDISC0C0rsC0COG0rs03C0O3NCDCOCO03CDCOCOrslsrs20CD3ZQ 

isisNisNrsrsisisisfsisfsisrsfsNisisrsisNisisisrsNisisNp^rsrsisrsisisrsrsrsfs 

2«MyNNOM0C««t«XN««l-O««HO24O2«JJI>-<I«>-JMCC(l)i-g, 
h-UCC^<t«UZa3Cl.OZI-<I0.UUZ-l3ZUp-UUr-Zi-i>HO^3UZU.XOZ3Z 



O I- 

X UJ u z 

O 3 UJ _' Ui III UUh CC 

boujuiui j z-icc ui a oh 

(occzmou <i cc z U i-jo ui a _i z o en cc 

uioui3<c<i a «uoozx<n«u. uzz _i <c h- cc o uj 

uj a>-cccci:zzt-"3i-LC<:i-i<t>-iui <i«oi-»-ivo_iz_i <cu._i 

£ZH£HH!iiMOu.Ojozzuu:Q«jjinz>zuij£«zizi- 

U.03_JZZ33aZh-i-H«0UJ UJaZii.i:iCOX<t0133Z<I ZK 
CCZOUJ Z JZ>-(0i:xuO3u.HH. LCUu.OiIiH|i|fihJ^«« 

3ujccz_i-iujujo_iuj<io zuiccca<r<r«3Z_icc_iouj>-<tccuj 

IJt01li:llJuIOO3Ib.3iLZ»iliJJiLlCZ«LU3irOL01 



3 

Ul z 

« >- o 

Z Q 01 

O 111 i 

r 2 u 
o o <t 
CL Z "I 



>- V 

I- z 

►H Z C 

u <i a 

Z _l 

_' a <r 

cc cc 

<t <t 3 

uj o u 

a. a z 



i- « 

<r -i 

CO 3 

c 

uj a 

_j <r 

t- <j 

Ol Ul 

U Cl. 



««<t««t<t<i<t«<t<r<t«m<r««<i<t<i<t<i«<t<t<t<t<r<E<i<i<i<i<t««<i<i<x<r<i<i<t 

»ooN'«9'MN'0-or , )r)iDoooNOiiico-ooiiiMriyi^(».-Orti;i»Mri-o<rricoHo.i>.Miio 




<i <i <r « c <r € 

rj <r fl- t o c c 

o aa O al IS M co 

■o is m >r o o> c 

o o ^ t« o o c 

O 111 <f Mil -0 9- 

o o o o o o o 

is rs co go co co co 



z 
<t 

ui 

01 

>t 

-j 
u 

>- 
a 



-162- 



O.LLiLLiLILIllLa.Li.lliLLIIIIIIIIIIIILIi.LILIIIIIIIZIIIIIIII 
I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I L I I I I 1 I I I I I I I I I I I I I 
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX 

in -o m in m •« ui m in -o in ui ui < in in -o in in in m in m in in >o in in in in in li~ ui in m m m in in in in in in ui ui in ui ui in in 



OOOCMOOCMOCMOOOCMOCMOOOrxOCMOOCMOOOOCMOOOOrvCMOOOOOOOOOCMOOOO© 
CN CM CM (MM— CM CM CM — CM CM 

CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM 04 CM CM CM CM f J IV CM CM N fv CM CM 1*1 CM CM CM CM CM CM CM I*) IV CM CM CM rv CM f J tH IV IV IV rv (V 
CM CM CM CM r J CM CM CM CM CM CM CM CM CM ** CM »i ~* CM CM CM CM CM CM CM .m »h CM CM N -h ri n h h rt h « - 



a 

0) 

_i 

Ui 

ae 

oo 

tv h 

o x 

^ « 
Of. 

ui cc 
a z 

X w 

UI <t 

O H 

Ul Z 

a o 
u 

3 

OC CO 

x ui 
I- cd 

<x 

M X 

to 

> UI 

_l 1-1 
3 ct 

T 3 

-) 
o z 



-I _l I I I I I I 1 I I I I I — I — I — t 

« <t<i<E<r<r<i<t<i<t<i<i<E<r<r<i<i 

CD CDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCD 
•O O O CD CM 

cm o o in 

CM CM 



-1 -1 


-i _i 


i i i i t — i i 


j Jin 


<r <r 


<z <t 


<x <i <z <r <z <r « 


<t <I N 


cd co 


o cd 


CD C9 CD CD O CD CD 


(DUO 



■ i ■ 01 en _j 

<E <C <r II<[ 

CD CD CD J JO 



©oomO'Civooooooomooorooooowonmoomo-HOoooooocD 
© © © cm o cm -0 © © o cd ui o o © >o o o r*> o ui ui © -oo ui r> o w -o o 

cm »o tv co © cm ui m o* «r in to o « *r *r o v ~ — oo n -c «*■ cm n 

CD<rf)tvCM«rfv«r*« , C0fv M inCM f) CM f) © 



o © o o o 



r i i i i 

oe ce. C£ it ct 



•2. -I 



CCCC (C 



_l -J CO _l 

I- K _l C£ 

X X CD I- 

<> -O O >0 

vvo X©©Z©— 1Z©J£ ui.ugygi.uu'j 

. . j ri r*i to DfinanHinziiiMDi'ii'irinDnrin 
o««<t<t«ou«<iuuu<r<t<iL!uuuuuuuriLc:u'_iC!:cjoci:u<Eivuci:cjcjcjcjLCUuu 
zi-i-t-i-i-xxi-i-zzzi-i-i-zzzxzzzzuiaxz:azaazi--*zfizzz:xi=ix:£x 



«o -o>o •fl-o -o '0>oinfv<o*4 > .or*> 

o^ii:i:j:^oo^i:oooi:^^oooooooo 
wzzzzzriMZzrinnzzzMronronpjMM 

ti <r tf <r <r<r n n <r ff n n ti <r <r <r l- u n u li c n M 



<0 fv <r >o sj 
© x o © © o 



Mfl N -O s) <J •« -o 

zqo©o©o©o 

" m n m 1*1 n 

X X X X Z 



oooo»-»ooo©o©r*i©o©©ooor*]©©<roooo©©©©in*i , mooo©r*iooocooooo©oo 
o o m cm r*i ui o ooc>o©o«ro o oon« oo cd o» rv rv »> n o o »• o e m o © ui 

o -o m o i*) in ut oofiooono o o o cm o o * in <o * o o n o o •* o cm w 



iv in 
to 



* o o h o n rai 
cd »-t i+ in 



o CM 
CM 



o m 



r*> in — ui cm 



00000*h©OOi-iOOO©0©0©0000000000©©000000©0 00©0©000000 



ic co 

3 X 

Q I- 
<X 

CO Ui 

I- a 

z 

Ui 

a co 

w co 

u <r 

CJ -I 

•I CJ 

tie 

« 

3 
U 

w >■ 

Z I- 

Ul ii 

-> a 

a 

CD X 

Z X 

II o 

> CJ 

-I 
o 

2* 



000000©00O0O©000»*000000©©— .OOOOOOOOOOOOOOOOOOOOOOOO 



— I — 1 — I I I I I — I — I I I 1 — 1 — I — I — I — I — I — I — I — 1 I I I I I I — I — I — I — I — I — I — i — i — I 



I 1 I — 1 I f L : I , i 



U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 



U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U.U. 



u. u. 

a 



UiUiUllxlUiUIUIUIIxlUIUIUIUIIxiUIUilxlUJ 
ZZZZZZZZZZZZZZZZZZUIUI 

HHMMMHMHMMHMHMMHMMZZUIIllllIU 

-J_l_J_l_l_l_l_l_J_l_l-J_l_J_l_J_l_l<i:<tZZZZ 

oooooooooooooocoooi-»-<i<i«<t 
cncncocncncncncnwcncncncncnoicnuioiLLa.xxxx^i:ir;^^^ 

«««4«<I<[«<t<t«<t«<t«<I<I<IlillillJliJUIU12 22ZZZ 

QOoooaoaQuoauuuaouiiziziHHHHHH 



UI UI _l 

a ao 

M M Z 

U CJ « 

H-t *-» U_ 

»- KO 

uuee 

Ui UI u. 

cn cn o 
z z 01 



ui 

I- CD 

<t z 
ui co 

CJ CO 

<X u 

cc 

_i a 

> _i _i 

a. cc <t <t 

ui _i _l 

a. z >■ > 

CL H X X 
Oll-I- 

01 UI UI UI 

>-> _i z x 



UI UI 

z z 

o o 
1- 1- 

Ul UI 



UI Ui 111 

z z 1- 

o o <r 

n-j 
UI ui s- 

^. J. lC 
CJ 

_i _i <r 
> >- x 

XXI- 
I- I— UI 
UI UI £ 



_i 1 I I I 

>- >- V >- >- 

X X X X X 

V- H h- I— t— 

UI UI UI UI UI 

z z r x z 



>- v 

X X 



ui ui z 
1-1-3 
<r «t 

_l _l _l Cfi 01 01 01 01 

>->-> 

itiOQOOG 

UCJU 

i<r<tzzzzz 

XXX 



UI UI UI Ui UI Ui 
Z Z Z 3 3 3 

u. u. u. 
-i-i-i 

J- >■ V CC Li Lt 

X X X o o c 
K I- t- t- t- >- 
UI UI UI O 3 C 

z z z z z z 



UI UI 

3 3 

U. u. 

3 Q 

I— t- 

o o 

z z 



111 



0) 



z 

Ui 1- 

a <r 
m a 
u 

z 



I*) 111 CM CM in CD CD OB CM O CM 1*1 

OrtOHONOO-llrtd 

vvvvwvwvvv 

iv o» m cm in «r <r iit oo s cm ui 

OOO-rtOOOOOO-wO 
VVVVVNVVVVVV 

CDNOBinrvCDUICDCDtvUTOO 

rvivivrvivtvrvivfvivrviv 



S3UTNnMrtUT*00CN^IV^OM3MCMH)riO-^O-'<rr*)IVa3O0-CD000D>>0-Oin*T--<^ 

n n h r; fi m h o o n 1*1 n m h n pi h o n « ri h n r-i pi (M n o ci ri -^ »*. -< cm now — 
vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv 

■o iii o Mil iiif ill h h n o id cut -o m *r < m*i >o o ui >i h c) ri -<j -o f iii n n >o m ri rt 

00>-<000000'-iO'HOOOO»-<00000'-iO-<0000000 — oocco 

vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv 

OaiCDIVIBOOUlCDy)VS3S3'fUlS3>OIvrvrviB-0*TS3CDCDUir^aoa:v(DS3CDUllilUl'<rul 
rvrvrvtvrvrvivrsrxrvfvrsrvrvivrvfvrvivrvivrvrxivrvivrsNrvivrxrvrxrvrvrvrvrv 



z uo3ir:«jiicaz<ts:«>-zi-<«i-z<[u«4o:TT5«iiiflj«3iuioc«j5i>-50>i-aoi^ 

O C0Z3OUU.OZi-ir>OU3i-<UOUZI-u.Z_ICJ<tZZ3ii,OOZ'lU3G01l3<Zil.i-«33^3Z J i3Zj:C 
l-t 



Z 
Ui 3 

M O 

UI z z 

_i ct *: <z 

-I 3 z z z 

1-1 a o 3 x z 

3 01 «c 

a z w >- u. p-i 

HUlOh JOC 
UIJ4HO« 

CC CD Z CJ CJ Z 



CO 
M 

-I 

o 
a ui a. 
Z Z 1 Ll 

1 z z * 

-i ui c o 

t- >- H-l Z 

ce ui a <t 
o x z o 

ClIAhlt: 



z 
o 

CD 

a z 

it w 

o r 
u. o 

1=1 o 
UI -I 

z a 



> a 

I- Z ui Z v Z 

>- Z mO OllXth O 

a ui <x ui-ui£DJhz k z iii 

Z -I Z^<£ CD_I30UIU0^010U 

<r: <rzuio_i>z_!crJX3 i-cjuiuiz 
<zoiuizoioizaoLr:ooui>-*u!oiuiuio<xa_i-iuiz 

■ o z _i ic o it o 

_ rsioct:<ru.oce 

1 ui « « h 1 « JDZ4 Ji: 

A3uiu.XAui<txai-o~i3L!:Z3Z>-u.>-cjzu.i 



o a 

JZJO 



> 

iiZ 

cj o 

o z 

it it 

<Z 

ui : 



ujjui^ujujxmuixuuui^uiujujiu 
U<I>-«01_I MZhh Jufflizy h J 
LiLinj030xuiitua:iiiM _j ™ u 
DtZCCMHOiJCIilDinuKKIHl 



I- ii 

1-1 <E 

-I -I 



1-1 it 

Z UI <c 

s: a. z 

3 3 *i 

01 it 



UI z 

CJ <t 

Z > 3> Z 

UI UI •-* c 

it -I -I I- 

O 3 -I -I 

_l « 3 UI 

U. CD 01 CC 



o a 

Ix. 

^ a 

l- u Ui 

z c <r z j- 

Ui it i^ l-H it 

ii u: a. 3 

it 3 i_ it -~ 

3 ui o 3 

O Z i- I- Ui 




-163- 



IIIIIIIIIIIIIIIIllLLl.IZl.IIIIIIIIIIIIIIIILiLLLiLll.LI 
I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

lo in li in « in in in in in in in in lo in lo in < lo in s: in >o ^ lt <> in lt lt lt lo ^ ^ 



©OOMOOOOPsls.lvOOOOOOOOOMOOONOOOOOOOOOrvOOOOMOOr'vOOOOOO'T 

M »H ix « CM »« •< M 1 ** 

rvNrvMrsNfsMMMMNNNMMisisjsisMivMMMrv.MivrsNNfvisrsMMMMMMMMMr-.MMMMMM 

rt M ~ H x -* w ^ « (N (N « »H »h « »* M M ~ f -i -< »< N r* »< « »< r J f 4 CM CM MM »h M M M M M 



2 
UJ 
Q 

*H 

u 
u 

<I 

li 
<t 
_l 

u 

X 

u 

o 

z 



-I -I 
« « 



a o 



i i i i i i i 

<z <z <z <z <z <z <r 

(9 O OO O OO 



« « « c <t 

oaoco 



oooooooooooooooooo©ooo>oocoooooooo©oooo<roocoooooco© 
o on o m m © o o n n « «< n in ooNt<o 

n wo- •« in m m ovt'cmo© m o go <o 

od »hn r\r^ nmm»*»*»h^-co 

_i_j _i _i _l _l i£ i£ _i _j _i _i _l _l _l _l 

Of Of CC OS CC l* Li l£ CC OC lC iX CC l£ i ll 

h- I- K h I- h- h- h H h h- I- hi- hi- 

ll inn » * -o in in m >o < in o in sj m in si n n Nnin in in n -« -c >o -o -c -o 

i:©^©©o©i:©o©o©i:©©^^:^i:©o© ©ji©©©©ii©©oi:©©©ii©ooii^©©ii^o 
2n2mnmn2nnnnM2«n2222rorenun2romwn2romm2nmw2nrow22renzzr*)X 

i-rt-xrrxi-rzrrrh-rri-i-r-i-zrr-fri-zrrri-zzzi-zrzi-zxzi-i-rzi-i-z — 

onvoooonoooooiiioosooooooocToooooO'Ooooooooooooooonoo 
inN>o©©o-oM©©«r©©Min©uT©iiT ©o© ©tvrvoorsoe-bT noooooiDieoonoo ©o 
in « in o in ooin«rvMNo-oo>o ono o©»h©n^©-om ooonittoo^O'O no 



M !*> w »h o 



in «r >o n ts 



O M M -h 



m iii mm •* •< 



Ul 

>-< oo©ooooooooo©oo«oooooooooooooooooooooooooooooooooo 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



_l_l_i_l_l_l_l_l_l_l_l_'_l_l_l_/J_l. 



_l_l_i_i_l_I_l_l_l.J_f_l_l-J_l_l_l_l 



LuU.LLLuU.Li.Li.ll.LLli.Li. 



LuLlLuLlIlLlLlLlLlLlLlLlIlll 



z 



Cfl 

■k 

a 
-J 



U.luU.U.U.LuLuLlLlLlLlLlLlLlLlllU.LlLlLlLlLl 

ujfflwwwwwMuicncnOTcoioenwcntnwmcfl 

oooooooooocoooaoooooo 

ZZZZZZZZZZ2222222ZZ2Z 

_i_i_i_i_i_j_i_i_i_i_i_i_j_i_i_i_i_i_i_i_i ..................... ....j; 

LJUJUJUJUiujuujujujULULLiujujuujLuuJLLiLij lominuiMiinninoiMininuiwiDLnwoitnoiuii/iuioiLi* 

33333X333Z'33333333=3='=; • •••2 

LuLuLuU.u.U.U.LLLuLuU.U.LLLuLuLuU.U.LuLuLu<I<I<t000OCO00a0O0a0C000OaGC00 3U 

XXX . . > 

IXL'LLLLlCirSOCl'irLl'L'irL-LLll-i-hZZZZZZZZZZZZZZZZZZZZZZZZZu 

ooooooooooaooaaooaaoazzx z 

hhhhKhhhhhhi-l-h-hhh)-hl-i-LLvu._l_l_J_l_l_l_l_l_l_l_l_l_J_l-J-l_J_l_J_l-l-l_l_l_il-' 

ooooooooaoaooooooooao<i<i«M««wi-iMHHMi-<Mi-iwi-ii-i>-ii-ii-ii-ii-iL<i-ii-iwi-iw« 
zrxxxxrzxzxrxxxzrxxxxzzzoaooooaooooaoaoooooacooaoL 

OMinMMorv>\n>orso3N^^<<^<Nrviv>NMivcBwrvooM>iiT».u'3MininNO»x'xt>.cnr)©u"iu")MM 

-4 »< O *< CM M « © O »h O »h ** M M -i O M © O -< ^ -< M O ^ O M © O M M © © .H M O O M M © O M ~ © ~ © ■** © M 

N«H«Mj.MiTfj(BaNi>>CBKflmrin<r-i'«r-iO'C»fiO'<nion<n>HNNNo>0'flO>iHrtsriNO 

OOiiO^0OOO©©O©©0©00©©O^O^O©O'-<»-O'-<©©O©»<©©O»xO©-<©'«-'©^©»< 

invui<»inhT*»vvui»v<^invuTinsjnN<in*H>»in<»winuTM'Ors.Nrs.a>y>«o*incosBr > «.aoDr*) 
rvNNispvNNrvpsNrsNrsN>«rvr^NrvivN^ivNrv(v.rvrsNr^rsrvPvrvrsNrsNr^rvi^NPxrvNrvrsivisrs 

K(ii«ijMiiiioxi:i:t«j«io)xiiixazh««o«i-<i>-i-xxii-i-i-55ii)h>>ni>->nz 

0*X«3arh«OZ0100ZI-ZH<ihrjw2_l3_>33hH03X.>ZZ*X330ZZ330U!-i 



a a 

2 Z u. 

lCSOO 
UJ to X 2 
u- '£. X i-i 

u- U U _> 

U<IhO 

_i -> en u 
<x « <i « « 

■O O-O * CO 

oo o r*v m *c 

m > rv -i t 

— © © o o 

-h a m rs © 

-H o ^ © ^ 

CD N GO go n 




a 

2 

« 

Ul 

a 
_i 
u 

1= 

a 

u 

L- 

o 

LI 
UJ 

UL 

<r 



-164- 



a xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxo.o.o.o.o.o.o.Li.0.0. 

a i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 

z zzzzzzzzzxxxxxxxxxxxxxxxxxzzzzzzzzzxxxxxxxxxxxxzxx 

ec -oinin-oininininininininininininininMJininininininininininininincjincjininininw 



rsoooocjooeorsoisoooooorSTHOocicjcioociocjocMocMOCMOoocioooooooo© 

«h (M v<*4 »<fMNCMCJCMCMCICMCI CM 



N«^NNC\irvN^h.MMMrsNNNNfSN^NWMr)MC4WWNWNNnNriCN«rj(N»<{\irv|s.tSNNNrir<l 

M „ it MHttn N ft ** «* >* •" 11 ** »< CJ CM CI CM (M CM CI NNNHNrtH«rt-HfJN 



4 <r 

O C3 



_l_J_l_J_l_I.JJ_l_l_J_/_J_l_l_J_l_J.J.J 

44444444444444444444 



-I -I 
4 <r 

o a 



■^ji f^M ^y ^j ^y ^y ^y i^y ^y ^y ^y », f i^j ^y ^1 i j ^y ^y i^y i„^ i^y < ^ ^y ^y ^y ^y 

oooinoooooinoooooooocjooTweoinocjoooooominooocoinooooooin© 
w -o in o rowpnowocjooTinooorscj o> 

in o> nniNN-H m m m n 



CI CM 



-I -1 
H- _ll- 

r t- r 

z 



at- t- 
u-r z 

* it 



_ii- 

t- z 

z 



I- 1- 
zz 



Q: -J 0£ 

a. i- t- 
•o z 

^ o it 



z 
is 

o ^ o 



M Z Z it it K IS x. . i. •« 4. i. xj — xi 

O Z Z -J 2 it T. 2 _l ZO Z ZZ Z Z j£ O it © X. o 

C«nZ«UZU<t3Z3UMU«Z3<H|i|«|<)Z<Z3«33UU3«3UyiilIZnZZZIZnun 

rxrsu4rsrs4Nrso:4L£N4N.j4Ci:.j4rxjo4rx4i£rxctcerxrxij;NLtisc>rsrx4U44rxis4i_!!scjis 

nr!iuf)f)UrtnfiuaniHai-uBtHisiunuanuartHOrtan»HHhru'--irtL'£-Ei'! 

OOOOOOOOOOU-lOOOTOOUTOOOOOOOOO-.-iCSOmOOOOOOOOOOOOCOOOOCCO© 

o» o o in oo n to cm m oonnn-o-oMooooo c o o © rs © o © © o 

^•o ~« cm N'T cm in o ci N>HMot»ooina) in in o o* ro © © cm o o 



»< n ■* »« cj 



is »< o cm ** oo 



»< *-« © 111 » -4 © «o in 

MM « CMN CM 



M OOOOOOOOOOOOOOOOOOOOOOISOOOOOOOOOOOOOOOOOOOOOOOOCO© 

-1 



©©ooooooooooooooooooooooooooooooooooooooooooooooo© 



— i — i — i_j e — i i_j_i — i — i i — i — i — r — i — i — i_j_i — i * 



— I i — I t 1 i I — I — l_i — I I — I t ( ! i !.-■ — i P 



U.U.U.U.b.U.b.U.b.U.b.U.U.b.b.li.ll.U.U.h.U.li.ti.li.li.lL.li.U.lkU.ti.b.U.U.U.U.U.U.U.U.U.Ii.U.b.ti. 



u. U. L. U. 



ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ 

44444444444444444444444444444444444444444444444444 

H-KHt-l-l-l-V-V-l-l-l-t-t-Kt-l-Kt-t-l-t-l-t-l-l-l-l-HI-h-l-l-t-Kt-V-l-t-h-t-^-H-V-h-l-t-t-l-h- 

wifiWic«)ii)iflti)Oiu)0)iBfflU)ii)inii)u)(i)cnwinii)ini)!(coiinio(oii)io»iaifl«iinii)ti)oimivjio)0)iD;o;-i-o-. 



o go a a a a so 
4 4 4 4 44 4 44 
— ■ — i — ■ — i — ■ i — i— j i 


casascccsccECceosocoaoaoooccctscc 
4444444444444444444444444444444 

1 1 t i 1 t 1 1 1 i t ( 1 —1 1 t 1 1 —J 1 I 1 1 — 1 t 1 1 1 1 1 I 


aa a a a 
44444 
i i t i i 


oosco 

4 4 4 4 4 

_l -J — _ _. 


zzzzrzzzz 

444444444 
zzzzzzzzz 

blUUUJlllUIUiUIUI 


z 
4 

2 
UJ 


zrrrzzzzzrzzzzzzzzzrzzzzzrzzzz 
444444444444444444444444444444 
zzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 

LUUJUJIiiLUUIUiUlUJUJUJLJbiUiUJliJllilllUJUJUiUJLlJUllliUJUJUlliJUJ 


XZZZZZZZZZ 

4444444444 

ZZZZZZZZ2Z 

UJUJLiUJIiiUJuJUiuiUj 


HI-l-l-l-KI-HI-l-t-l-l-KK>-HKI-KI-l-l-f-^h-f-l-l-HI-l-HI-l-l-l-l-V-l-t-»-l-»-l-t-V-l-!-r- 

zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz 



« 4 4 
a. a. a. 

■* tn n 

CM OO 
N VS. 

<r t cm 

O O -H 

s. s. s. 

in -o in 

IS IS IS 

x 4 z -t 

*- :> o z 



4 4 4 

a. a.a. 
cm in is 

iM oo 

S. S.X. 

0> IS T 

OOO 
s. s. s. 

in in <o 
is rs rs 



444 

a. a.0. 

O Or* 

m o ** 

N X N 

«h w cn 
ooo 

s. S. V 

in Tin 

IS ISIS 



4444 

i1-u.Cl.Cl 
«0 T f) T 

V X % s 

O O M OB 

% S, X X 

n <r «o in 
N TS rs rs 



o. u. 

is CM 

** CM 

■s s. 

fS ON 

o o 

"s s. 

w in 

IS IS 



<t « <x 
a. o. a. 



<c <r 
u. a. 



<o o in r<i n 

r-i o»< 

S N N 

~ «o in 

i- o o 

s. s s 

is is N 



S N 

CM b"> 
■^ O 
N V 

111 T 
IS is 



<E <t « <t 

o. a. a.0. 
o «o ~> o- 

n CM CM CM 
S. V N S 

•h v< on in 
O ^h o o 
s. s. s. v 

«o in p>. <« 
rs rs rv is 



<z « <c 

u. 0. 0. 
rs on n 

ONM 
X N V 

■o in on 
ooo 

N S S, 

*o •< «c 



« « <I 

a. o. o. 

CM CM CI 

V V V 

H (SH 

*H O »H 

N N V 

•0 «0 is 

is rs rs 



<i <t <r 

0. 0.0. 

M'rt 
O CM M 
S, V N 
0* CO M 
OOO 
N S S. 
^0 H) IS 

is rs rs 



<x <t <t 
o. o. a. 

On ■* M 
W M O 
Ny NX 

T CS IS 

ooo 
s s s 

■o rs >o 

rs (SIS 



0. 0.0. 

CM 03 CD 
OOO 
s» V s, 

rs n rs 
ooo 
•s s s 

■0 "O -o 
rs rx rs 



<z « « 

0. 0. 0. i 

•ooo 

CM CM »h 

•s N V 

00 O CM 

O *H *H 

N S S 

CO -o -o 

rs is is 



•rt CM 

o ^ 

\ \ 

»• ro 

o o 

>r in 

is IS 



<z « <t 

. 0. 0. u. 

\n f v 
cm « CM 

\ N X 

M CO N 
OOO 
\\\ 

in iii iii 
is is rs 



<r « <r >-i 



q «r « 

et -t o 

V s s 

-0 CD C5 
OOO 

s. s s> 

W GO CO 

is is rv 



uo>cc<z«««N<zz<>njziOHO>Ho^j«t««ijhi--iHxiii«<uoiu- 

ZXZ<EUI-OCt.r>«a.M»-0.3£«>HOEXZ33ZOMi-<a.l>0.O<E3-3ZZI-Zt3_l(0XOZZ 



1C 

at 

-10. 
HOZ 
Z u. O 
111 cc o 

« o cc 
t- z a 



UJ 

-I 
« 
en 
I 

ZZ 

oo 

K I- 
ZU1Z 

<Zh 

Ul M_l 

Q 3U 



o 

Z_l 

« o« 

Z> wO. Z 

« CC M 

t- uC Z 3 

axiau 



UJ _l 

O M 

z z 

<t 
it o. 

u z 

« <Z 

-1 CJ 



a cc 
z o 

zceo 
zujiz 
cj a. _j 

M 3 w 

ce en z 



o 

<r ce 

O 3 
Offi 

cn o to 

3 ZO. 

1X1 <r i-i 
x. *- _i 

3 H- _l 

_| « M 

a zx 
(J cj o. 



> 

Z Q 

« -I 

ca ui 

ce _i w 

uj « u. 

o. u. 

cn 3 uj 

<t uj X 

u 2 cn 



cn a 

3 -J 

a uj 

z f> 

3 U. 

-1 z 

o <t 

CJ u 



-I UJ 

UJ -I 

«-" <t 

u. e 

C3 Z 

Z w 

Lt _J 

0. UJ 

cn z 



o 

<r 
_i 



O Z V > _J 

Z ZOZUJ<tt-l- «w 

«U3Z3ZIhh>ZIiJJ> 

u. 3 uj x i-o <r o« o ou z o o o in 

o a a !5 K I- J I- j z it i- 2 2 it it 

z <tozocn»-cnt-i-iLect<rxuj<tujUi 

NVaU£HU.H l ^H||)£<[{||jU£HhZ 

ot a z.N-i au. 333uo:aa^HOfitcz 

it O O i- 41 k 4 III O UI it h ui U it _l 2 <I UJ 
WOlL34UJJUJUJiUUlllJikMUZ 



44444444U444S44444 

«rTCJ-H-oi*5isrtrsooTCOco-or-Jcoo>o 
uico-<iscKwT<T'ri>'>s3'Or<3<ro^cocD 



44444494444444434444444444 

Tomtorors-o>oii3'OOOOCocMOOisisrjb3 0(>rjrOT 

fflN<rrtMM»nHfj»»'OO»».>»*o>0»'»NriN 

»-• in O CD li3 ^0 w «h CD •-! I*) O IS r-4 r-J «C T CJ •<) *0 T *0 On rs IS rs rx pi t^ oi uj n r-i ^- r-i M3 do o o hi ri ix ^- S3 
OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO^OOOOO— wOOOOO 

inv^c>-NTC > iuTChwOMCooNOCJ~o-of-iincjrjos)-o>ow»HorooNCO'rii3<Trsisrsrso.wfiONW 

000000000«ir<000^»HOOwOOrt»<000»<'-i'rtOOOOOOOOOOO'H«HOO 

n'<i-obiiii-oiii<rwn<r-<iii')Miiiiinr<rn«>oiftN>o-<i>o>0'C'OiB'0>oN-oNM)>fl-o>offl>o>o<rn 

• • • • • • 



z 

5- 3 

I- O 

Hl-Z 

o cn a t- 

r i- Uj 

ct cn 4 Z it 

uj c w 4 in 

i- cn _j Co n- 

z: 2 _j it it 

3 4 — O 4 

W it 3 Z l_> 

4 4 4 4 4 4 

o in cn >o n !*■ 

w »H > C CN T 

tn o c — «r rr 

O iH o o ~ •« 

<r co so rs cd co 

O O o o o o 

in iii w m co cd 



-165- 



CM 
M 

Ul 
O 

« 
0. 



Ul 



l4.lIII(uiLiIIl4.4.1Ii:iIIIIIIIIIIIl.IHIIIIIIIIIIIIIi.l.i!L 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ! I I I I 

zzzzzzzzzzzzzzzzzzzzzzzzzzzxxxxxxxxxxxxxxxxxxxxxxx 

in in in in w in ** m m in in in w m tn -o m in in tn m in m m in in m m in -o m in in m u-i m in in m w m in id in in in tn m -o m 



OOOfsrsooOISOOOOOOfSOOOCMCMCMCMCMOOOOCMCMOOOOOOOOfMOOOrsOOOrsOOO 

mm M m CM CM CM CM CM CMCM CM M M 

CMCMCM^NCMrvNrvll^CJCM^fVNNNNnCM^NCMCMCMNNNNWNnNMr>ICMCMCMr-4CMNMCMCJCMCM~0Nrj'-< 
CM CM CM M CM m m —CM firtM m m (M M CM CM CM M mCMmCMCMCMCMCM CM CM CM N CM CM m CM CM m 



a 

CO 

-j 
Id 
Of 
CO 

(S H- 
C*. Z 
m < 

at 

ui oe 
a z 

z »i 

u « 
u i- 
u z 
a o 
u 

3 

or, co 
x UJ 

« 
n z 

rs « 

o> a 

M 

CO 
>- Ul 

-J M 

3 QC 

") 3 

-) 
C3 Z 

Z m 

M 

ce en 

3 Z 

a i- 

a ui 

y- a 
z 
ui 

a oi 

w a 

u <r 

u -J 

« u 

OS 

« 
-I 

3 

u 



Ul m 

3 a 

o 

C9 Z 

z z 

M O 

> o 

-I 
o 

3 



-I -I -I 
« « <t 

QUO 



_I_J_I_)_I-JW_I_I 

<t«<t«<x<xa<i<x 

OOOOOUJOO 



-I -J 



r i ico i i : i i 

<i««N«<r «c« 

OQOO10COI3O 



<X « <E 

ISQQ 



<x <r 

o cs 



ooooooooooMooooooooMinoomonoooooMooooamooooorsooocoo 

» N «■ O ON O fSCMOOIs^-riOOBOOO ©OOOIiaOOCM 

cm»cm o «o in is a o m o* w rs rs m © rs m-o^omrsrsoriM 

cm j w «c cm » * rs <o rs r«i m -o m r«i m w r«i cm 

CM 



Z <0 

-I Z O 

z "-> 3 n 
u o.a z 



-i * 

ce of 

i- t- 
in w «o 

znznn 

•c u c o u 

i- z h r z 



-i 
ce 

i- 



_i 
ce 



ce 



0£ 



> 



oe 

^ in cm in -o m -o 

ZOOOOiCO© 



«i «o »o -o ^ w sjcm^o -o >o in «o <o <o -o -o ^ in cm in -o r«i -o 

^eoo'icoozo z o m o o iioezooooo zooooico© 
znnznncniiiiijjnMMijnuiiizwioziofiMMniijcnionfizinn 
«uo«uojursrvocuuursuisis«uo«uooucjrs_iuuuu«uu 



-i * _i 

ce ce ce 

i- i- i- 

o 

4. © iS *£ 

zunzz 

i- th r k t- 



oooooooomooooooooooooooooooooomaooooinooooooooooooo 
o o o o o o min © o rs is o o moooomoooorsMciooo wooooooomo 

OOOOOO O M OMON MO OOOO CMOOO «r M is m m NOO<OMOOblHM 



in if) o © -o m w 

rs m M M m 



m o 

CM 



ui in o cm 

CM CM IS 



CM CM © 



»<cMeMfooNinin^ 

M CM 



00©000000©000000©00000000000000©00000000000000©000 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



l_l-J_l_J_l_l_l-J_l. 



— ! I — i t — I — I I 1 I I I I I i I I I ( I I I I 1 I ^ I ! I I t I ! I 



u.u.Ji.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.i^u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u. 



Z Z Z I- t- l- 

« <t <t <z <. <z 

hl-hJJJ 

01 COCO _l _l _l 



_J ! I 

I ( I 



aaci-t-t-i-i-!- 

4«<twinwinw»! 



zzz 

<t « <x 
zzz 

Ul Ul Ul 



a a a a a a 



en 

i- 
z 

Ul 

a 
m 
u 

z 



zzz 

MHM 
« « « 

ft. 0.0. 

ri ro n 

CM CM CM 

ui v. V N 

a V N. N. 

N Pv IS 

rv rs n 



zzz 

3 3 3 
Ul Ui Ul 
I I i 

o o o 

ce ce ce 

t- i- i- 

Ul Ul Ul Ul Ul Ul 

u. u. 0. u. u. u. 



ZZZ 

3 3 D 
Ul Ul Ul 
-I -I -I 

o o o 
ce ce ce 



u 

o 2 

CO 

o- o 

•* z 
I 

W K 

•« AC 

1 ° 

« ui 

■» oe 



« « <t 

CJ uo 



in ok m co 

cm ■•* cj o 

"S V V N 

ri cm m \n 

o «o o 

N V V X 

iii von 

is rs rs n 

O Z <£ <Z 

Z Zw 0. 



coo 

rs o 
o — 

V S. 

(SIS 

-10. 



ce a oe 
ui ui ui en 
K H- •- ui 
zzz z 

Ul Ul Ul •»■ 
(J U O 0. 

Ul 

►- K K 11 Ul Z 

ce ce ce a _i a 

ui ui ui « o K 

oi oi oi a ce z 

Ul Ul Ul « >-> M 

o a a _i o > 



z _i 

Z M_J 

« Ul Ul 

r ce oi 
ce om 
ui _i 3 
ou.ee 



X Z <I 

I- KI 

III- 

0. 0. u. 

n <z <r 
zzz 

zzz 

3 3 3 
Ui Ul Ul 

I I I 

o o o 
cc ce ce 
t- t-i- 
ui ui ui 

0. 0.0. 

* o in 
o ^o 
V s. s. 

■o •« rs 

o oo 

N. "S X 

* co n 
is is is 

x i _j 

h- O n 



3m« 

Ui z> z 

H UJH 

=► _ise 

QUO 

■z. cec 

O M O 

_l uz 



x xr 

hhh 
XXX 
0. 0.0. 

<t «<r 
zzz 

zzz 

3 3 3 
Ul Ui Ul 
I J I 

o a o 

cc ce ce 

f- y- K 

ui ui ui 

o. 0.0. 



o a a a 



z z z z z 

o o o o o 



z z 

a o 



z z 

a a 



zz 

o a 



H- i- b- h- K 
3 3 3 3 3 
-I _l -I -I _1 

uooooo 

Z 01 CO 01 01 01 



3 3 

_l -I 

a 

01 01 



3 3 

-I -I 

o a 

Ul 01 



I- t- 

3 3 



ce cece ce 



o a 

01 Ul 



azzzzzzzzzzz 



ce oi oi oi o> oi 
> ui ui ui Ui Ui 

ci. cc cc cc ce ce 



01 01 
Ul Ul 

oe oe 



01 01 
Ul Ul 

ce ce 



01 01 

ui ui 

ce ce 



» cm ^ in 

o ON w 
V S, V N 

CM 0* O -< 
-i o — o 
N. N X -x 

in in <o in 

IS fs IS fS 

x«<to 

H 0.0. Z 



CD 0* 
O ih 
"S V 

CO <0 

o o 

S. S. 

m ui 

N IS 

■> z 
zo 



«o a in >o 

hMNO 
s. N s. N 

n ■« «• n 
oooo 

X N V N 

<o is «o a 
is rs is is 

z x « K 
o t-u z 



<0 CD 
O CM 
S N 

n -o 
o o 

a rs 
is rv 

zu 



in is a 
o o — 

S. N N 

•0 IS N 

o o o 

V s. -s 

co co a 

fS is N 

Z«M 
MUZ 



Z Z Z X 
0. 0. 0. 0. 

co oi oi oi 

<x <r <: <t 

a a a a 

« « <E <E 

OOOO 

cc cece cc 

a m w n 

N N V V 

o- >o >o in 
oooo 

N X s. S. 

IS MS (S 

a aui 3- 
z a z z 



a oi 
oo 
zz 

a a 

z z 

ui ui 
^ ^ 

-i -i 
o o 
a a 

in cm 

CM w 

s. s. 

fl CM 
O *H 

■o w 

IS IS 

o <x 

UL 



. . . oc 
a a a ui 
• • • z 

oooo 

... 2 

z z z o a a 
a a a 3 3 

HKhlllOO 
Z Z Z Z ii i-i 
Ul Ul Ul Ul -I -I 

^ :> 3 ce 

_i _j _i >- cece 
o o o *- <t <E 
a a a a i- h- 



3 3 

c cs 

MH J 

JJO 
3 

ce ce -i 
c <t o 



Ul Ul Ui 

-I z z z 

O Ul Ul Ul 
3 3 3 3 

I I 1 ! 

OOOO 



Ui 

JJZJ 
O O uJ 3 
3 3 3 3 
-1 -I -1 -I 
OOOO 
I — I— I— H— 



«r ■» a 

WOO 
V V N 

•CON 
O w w 
N S. N 

<o » rs 
is rs is 

« 3 O 

0. 3 U 



o lt a 

CM O CM 

N N V 

n ■» o 

o o w 

v v v 

is -C -fl 

is is is 

CJ «o 

Z 3U 



CK Ch 

^4 W 

S. N 

\r> in 

o o 

•O SJ 

is rs 



■o w 

o -< 

rf CO 

o o 

>o un 

is fv 

u « 

z o 



rs ck n -h a 
w r-i ci m w 

X % V V X 

•o no ri o 
o o O «H o 

\ X \ X S. 

rs m oo r«i <o 
n is is rs rs 

v- « (J _i _i 

33 Z w >h 



a k x 

3 ce o 
ui s z 
ce 0.3 
a z <r 
z <r _i 
« ^ a 



i- o 

HOC > 

U O I- \- 

a z w 

tn oi o u 
cur 
a a ui ui 
z uj ui z 
« 3 ce i-i 
K a u. _i 



o a _j 

a z 3 

<r <t o 

o. -i a 
4. a 

_l « M 

ui a z 



« 

oe a 

« -j 

<t _i ui 

-JO" 

3 U. 

o <t z 
a i- ui 
a z ui 

w <r cc 
r oi a 



301 

o a 

JN 

-I 0. 

M <Z 

3 ce 
z 
o a 



a 

Z K O 

3 O Ul 0. 

o o i- a 

v- cc >- z. a a 



o 

a ce 

*: z <t 3 

u z o a a 

ceoaui acez o_i<zzzi-3a^ce o 

<Ii_ii_i^ ZU«^ JOUHHUZOIQIiJZu. 
— WCe (DO JOUiCLO J JJUJZJUU 

*^ ^ 1^ .*^ >_i ^^ .-^ ri . i **• i y Ul 



Ui H 

_i a w 

_i ce u 

M 3 Ul 



ua<ic<i<i«<i<i 
e o o e f i -o n -e n 
CM cm ri rr ri o- o -o ro 
~wrtinm«oars 
ooooooooo 
«-<^i«»nofxr>.o 

OOOOwOOOw 

egooiii«oiii«ift 
• • • 



««««<i««««<i<t«a«« 
ui w o- <r r i m o M a r j •» iii v * «r 
o iii -• >o o cm w o n is <o *4 m m o 



a. oi Lt uigjguKiLUjjJiuj^^uiuj 
cnui «inazhi(H<i£033iiiij<ijiu 
HH««4«30JI0«<t«CuC<tOH{i: 

azz_iuiuazauzo.occeza3ocaaii. 



— ^ u i ~ -v v^ i '# nj s^ i"J i» u " «j »i v i w *« i '* v>i w^ ■*■ hj ri v v* ^ 

f<N<r»'Ort»o)rt»MnooiiitnH»fHNoonooo> 

©OOOOOOOOOOO'irt'HwwwOwOOOOOOO 

Nrarswo>»<Marsf>)rsmnMfS'«rsrsO'0<o«o»cMfs«rcM. 

000<40<-<OOOOOOOOOOOOmOOOOmOO^OOmOOOOOO 

«-aminin>oininin«ois<oaarsaaa'V<o<o«'<oms)isrsis-o<o<o«OM)b')isrs 
• • • • 



V* U* \ 4 If If ^* ~*J \~* »-l 

OOOOOOOOO 
OO—OOOOOO 



rs in 

CM O 

s. V 

CM CM 

^ O 

V S. 

N rs 

« w 

M Z 



Ui 

-1 
_l 

M 

3 

a 
ui z 

_i ui 

<r z> 

Q UJ 

O h- 

z a 



<L <Z <L ZJ <Z 

«h t-i -o >o r> 

•-i cm n a > 

yi o h n o 

O O rt O o 

cn ^ a »* cm 

o o o o o 

a v •« is * 



a 

ui 



z 
c 

a 

a 
<r 



a 



UJ 

i- 
ce 
c 
a 

ui 

ce 

c 



-166- 



UJ 

a 
o 



a.a.xxxxxxxxxzo.a.a.xzz<LCLXXxxxxxxxxa.a.a.a.a.a.a.a.xxzxzxxzxxxx 

I I I I I I I I I I I , I I I I I I I I I I I I I I I I I I I I I I I I .1 I I I I I I I I I I I I ! I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxzzxxx 
inio-omwioinwHsminm-c-oinuiinuT^o-O'Omi/imm-' m m m m m m in in in in in m in in in in in m m m in >o >o m 



©OrsOOOrsOrsoOOOOCMfsrsOOOOOOOCMOOOONOOP-JOOOOOOOflOOOOOOOOO 
r4 r* w* CM — — CM CM CM CI 



rs CM CM rs CS Is f> rs CM CM CM CM CM O CM CM f) PJ CM CM fs CM CM CM CM » CM CM IS CM CM CM CM CM * CM CM PJ N PI CM PI PJ PJ f 4 CM PI PI P J CI 

— — — — — CM CM CM CM CM CM — CM CM CM CJ CM — CM CM CM — CM CM CM — PI P^ P-l PI CI CI C I C-l CM PJ 



ooa 



t i * in co cn cn cn in cn en 10 en in cn_jcn m j j uij w ti n 01 otjj 

<I •£ -C A A A CO h- A A A A A A A <I Jj £^CfflCS£SA£K 
OOO J _J _i _| a, _l f t < i J JO J _100_ia_J_i_l_l_l_l 





UJ 

cc 


oooooooooonpj 


©oooooinooinininoomoooooo 


OOO 


OOOO 


OOO 


OOO 


o 


o o m 


CD 




o rsis 


O OMIfl < < n O O OOO PI 


o o 


o o o 


o o — 


o «r t 


CM 


o o — 


IS 


<l~ 


oo mo 


ok — cm is o in Pi in o -o 


o in 


o o — 


4lMi1 


CO 




o o 


O 


z 


*■ 


*■ cm n > t a o 


*■ CM CO 


— CM 


— 




is pj 


— 


« 




CM 




f* 








n 


cc 

UJ 


cc 


*: -J J 


_l _i K co cc jqjjj^j 


_l ►- 


_l t-Zii 






A 


z 


cc i- ae 


ut cc cc -j a cc _ito cc i- cc cc cc cc cc cc 


CC 


CC A A CC 




X 


►H 


t- Z 1- 


t- h t- a. u. u. i- _i i- tn t- t- 


l-hh 


t- a. 


1- cc 


1- U. U. 


ca 




UJ 


<t 


-osjin-ois rsm <oin 


10 u. t i C M 




m jc 


-0 UJ 




u. 




O 


H- 


ooo'eosfzooxeo 


^ o ^ * cc x -Z. ~ *. 4. jL jL 


X X. Ji 


jiZOZ 


jc o a. 


3£ Z X 






UJ 


z 


MMMMMZOMMZWr) 


zuirozujujz zoo ZQtnzzzz 


z z z 


z Z rn « 


z n a. 


Z 3 3 


X 


T _' _ 


A 


a 


uuuuu<rccuu <r u u 


<tlSO«NIS<tlSi-lCC«>0>0««_iU«<t<I« 


« <z <t 


« « U _l 


« o o 


Cii 


a 


(••* — — 


3 

cc 


u 


zzzxzh-oxzhzz 


i--ri--r,KiiijGayn'!ua*ri-i-i-h- 


l-l-h 


1- H- X A 


1- X X 


i- a a 


A 


to CM CM 


en 


oooooooooooo 


OOO-OOOOOOO'TOOOOCDO-'OOO 


CK o o 


n o o m 


o o -o 


o o c 


<r 


OOO 


x 


UJ 


vooin oo oooo 


ooooo o oooo mino oopi 


moo 


N O O PI 


o o n 


OOO 


•r 


OOO 


i- 


(3 
-I 

z 


won* ocm o o o -o 


otonx o oinmo cm to o © o to 


r i CO UI 


•0 0>O 


m m — 


o — - 




m ut to 


f*> 


n in — * w o o — 


— mo— 10 — -ocm no inn 


•0 ts 


n m 


n v 


CO 




IS C-l 


IS 


<t 


— CM M) M) 


— p) — — *■ 




v4 








— n 


— 
> 


a 
en 

Ui 


M 
















-J 
-) 
CO 

z 

l-l 

ac 

3 

a 


ac 

-I 
Z 

M 

cn 

X 

i- 


00000000—00000000000000000 — 000000 

— 


OOO 


oooo 


OOO 


OOO 


o 


OOO 


oooooooooooo 


ooooooooooooooooooooo 


OOO 


oooo 


OOO 


OOO 


OOOO 


to 

1- 
Z 


UJ 

a 




cc cc cc cc cc cc 


cc cc cc 


cc cc cc cc 


cc cc cc cc cc cc 


\£. 


cc cc cc 


Ui 
A 
Hi 
O 
U 
<I 


CO 

U) 

<r 

-j 
u 




M tM N ISI tM N 


NNN 


NNNN 


IM IM IM 


NNN 


N 


NNN 


i _i i i i i i i i i i i 


jjjjjjjjioonnniiiuiaaaaafiaaaaaaBa 


a a a 












!T LJ " 


p* ^ 








u.u.u.u.u.u.u.u.u.u.b.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.u.ooooooooooooooooooaooao 


cc 






jjouuuuuum 


CM CM 


PI P4 1- 1- 


t- 1- h- 


1- X X 


X 


XXX 


<r 






• • -330I-ZZZZZ • 


• • 


• «cc cc 


CC CC CC CC w >-i 


>-* 


fc-t t-l H-* 


_i 






co co co cn cn — w i i i i iv 


V V 


v v uj uj 


UI UJ UJ UJ X X 


r 


XXX 


3 






• . • ^ ^ v U. Ui Ui Ui UI UJ 




u. u. 


u. u. u. u. 






u 






o o a t- t- _j t- i- i- i- t- >- 


t- h- H- 


h- f- 




uj ui ui uj ui uj 


w 


> 


JJJ 




cc cc cc cc ac x x 


XXX 


Xhl- 


^~ 


1- 1- 1- 


X 


i- 


Id UJ UJ OOO 


ouiiiijjjzzzuiui cnccccccccccuj 


UJ UJ UJ 


Ul UJ i-h — 


WH i-* +* 


HHH 


t— i 


I-H Hi t-( 


u 


w 


t-t-l-_l_l_l_IZXX 


-luzzzaoo cvCv^oki-i->-i-u.u.u.u.u.u.zz 


X X X X 


cc 


cc cc cc 


3 


a 


««<tooooooo 


OOO'jJuiJJJCDOlOl u. ii — — — — — 








O o 


o c a c 




o 


Ht-t-XXXXUUU 


i i o _i _i > >- > a a a cn cn a z z z z z cc 


cc cc cc cc 


cc cc cc cc 


_j 


i I 1 


o 


z 


UJUJUJOOOO — I I I 


oo_i>->-xxxi-iwtH33cn>- k 


H- 1- t- 


1- 1- t- »- 


1- K 1- t- 


z 


XXX 


z 


z 


UUUUUUU<<4 


ao«xx^w^_i_i_io:ceinirzrzx>-i 










u 


uuu 


— 


o 


«<<JJJJ 


_l _l -^ o O O O O UJ 3 3 3 3 3 Z Z Z Z Z ZZ Z Z Z Z Z O O O O O O 


3 


o 


-J _i <i <i <i <r _i -j _i 


<r <r _j uuuioiunDiijtMMMMH 








U. LU 


ii. ii. u. u- 


-1 




oo_j_j_j >>>- 


>-J-JZZZ 0.0.UJ3ZZZZZZ 


z z z 


z z z z 


z z z z 


>- 


>- V V 


o 




33>v>aaaaxxx 


aaioauuuiizwoi^Hoooooo 


OOO 


o o c o 


OOO 


O X X 


X X 


3 




-J-IZZZOOOOI-V-l- 


oot-_j-i-i-j-i<i<c<zooaA££sxi:c 


z r x 


r r z t 


X £ X 


z 






z 




OQhhhOQOOIiJUIUI 


ooui>v>-v>_i_i_jxzrorxzzrt 


X z z 


X X X X 


x. r j: 


X « <t 


<I 


<t <r <t 


i— 




»-l-3333333XXX33XXXXXXU.U.U,Ci.a.l0in«<r««<I<I 


<!<!<! 


« <t « <t 


<i <t « 


«uu 


u 


uuu 


to 




'««»na«oinHono 


0>OCDIsCDOfsinnNls«|SNrsCD— CMCOISCD 


— n is 


ono-o 


MMO" 


r> ui m 


in 


CO CD — 


i- 




HrtOONNDrt|<)|<)NI<) 


OMCMOCM — CM — OOOO — CMOOtOO — CMO 


— — O 


ro — O PI 


— NO 


PJ — — 


— 


o o — 


z 


Ui 


VS.VNS.NS.S.S.VNS. 


NS.NNNVS.S.SVNS.XNSVV^S.N'S 


s. s. -s 


V -s \ X 


N S. V 


\ N \ 


s, 


s> ^ \ 


UJ 


t- 


^co — cm— cmmo- — o-in 


<r o m» -o -o fi « <r n n ri n fi -o n n n n f n 


o- pj w v p-i »o n 


m -o *■ 


•o n m 


ro 


ts is O 


A 


« 


OOhi40hO«iOhOO 


O— OOOO — — OOOOOOOOOOOOOO — o 


O — O O 


OOO 


OOO 


O 


o o — 


M 


a 


NNS.S.VXS.S.VSSS. 


VS.S.S.SS.S.NS.V-SVSSXNXS.S.SS 


s. s. s. 


Sv V V V 


V S s. 


s. V V 


s 


V S. V 


u 




io»nwin*<in*Nmco^roo»incDM3ffl*ocDNCD'»>o«oiiTisiscDinco<risinrsiiT>ofs-o«o 


>0 is is 


rs 


is is ^0 


z 




rsrsrsrsisisrsisrsisrsrs 


tsrsrsfstsrsrv.rsrsr».rsfv.isisrsrsrsfsrsrsfs 


rs is rs rs ts rs is 


fs ts IS 


rs is is 


IS 


ts rs is 



jnux<cozn)<(ii")>>jo<ui<H>zz«z<x«ai-<>tNHii)zz<j<o!zieaaa«<< 

«ZC0»-«ZI-^-JZZZ3U.ZOZOM3ZMMQ.t-iC3t-U>->3a.3Z«Z^i-iZ3Mi-iO>HOXXXOC3O 



o 

co 

0> 

— 
I 
m 



it w: 

U| (J A 

UJ o_i 
i- cc cc uj 
uj u — 
cc ouu. 
uj cn a -i x 
i- to « i- in 

cc z Z h- CC 

<I — « M <t 

oj:oji 



mz« 

3 O 
X I- t- 

cn _i cc 

<t O O 
ZIO. 



CO 

>-. CC 
3 UJ 

O H « 

JWu 

— z 
y- z « 
cn — 3 

x <t 

> a z 
« uo 

A A I- 



(0 3 

O UJ > Cv 

Z UJ UJ UJ UJ UJ — ui I- 3 CC 

M O Z _l Z Z -J 3 -I Z t- 0. UJ 

CC O CC O _l > > _| JU Z CC CC -I 

C I- Z <t t- Z— <t<I— <t UJ I- — ZUCC Ui CD Ui _l 

U1ZO J0ZU0533 M-Mth 3CCOOOUJ3C>- V3Z3ZZZZZ — 

UIZ3Z— -icccn ujzccccujzjcujcci-ujua.^uj «<ei-<xoo'o>-<>-i:> 

X. X <Hj4UIZhl-UJ<Hyj<(JUClL3UIJ0J03IJII-l-hJJLI 
U-IAH-XCCAXZCCCC — _l_l« A. A >4«>MOklUHZJZJJJWU)inaiiiu. 
04J4liiU043QOOeiJhdC43UICCU4JUi:iHH0040C4C433< 
CCCvOU-IAXUAU.U.UJA4:Cl.XCn-IU.XAUOt-(n3U.a.UXCCXUJUJUJAAX 



<i<t<i<tu<r<i<r<i<i<r<i 

M l )D*'OWio>f»n»0' 

»0>ChlO«OISOVUTIS— * 

m«oopin — to — — mn — 
ooooooo— oo— o 

— 00 PI — CM — ^OCMPJ— ts 
OO — OOOO— o — — o 

m*M*iniii*ifl»Mii(D 



•I A <X « 

— >o o n 

— «o pi ^ 
o — n pi 
oooo 
m — co i> 
o — o o 

* MOB * 



1 <t U A 

CM PI >0 O 

m rs co cm 

— n — n 

o o o — 

oo rs — — 

o o o — 

m co rs co 



««a«<c<:a««« 

PJ PI CI PI CN — V CO o » .. 

rj pi pg pi m oo is is is *■ ts 



«<t«<I<t<I'«<IC<I<EA«<I<IAUA<t« 

uTiso-on^-^om-ouiooPio — — — ooco 
tspiis-oiso — isnooom*mcso>csp|pjfo 

i^. i*w ma /-»» j-i i^. t*\ r- i i,-\ ^». i^. i. - 1 > j,"i krt .^ j*i i*v i-k «rr 



cn 
ui 

A 
O 
U 




-167- 



ro 

Ui 
to 

<i 
a. 



a cvo-xxxxxxxxo.o.o.o.o.o.o.xxxo.o.xxxxxxxxo.o.o.o.o.o.o.o.a.a.xo.o.o.o.xxxxx 

O I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ! I I I I I I I I I I I I I I i I I I 

r xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

as ss in >o m m in m in in in in cm in in in m in in m m in in m in m in in rs in 10 o in m m « in m in in m in in in in S3 m m m n m 



OOlSOOOOIsrsOOrsOOCMOOCMOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 

h <h «h 1-1 r<i cm 
ro rv rs is cm cm cm cm cm cm is is cm cm cm cm cm to cm cm cm cm is rs is cm cm cm cm cm cm cm is cm is cm rs cm cm rs cm cm cm cm to cm m rs rs cm 

-4 .1 CI CM CM CM -» CM CM CM CM CM NPINrtrt^NCJ CM CM CM CM CM H CM H CM 1 CM CM ft CM CM CM CM CM CM i »s CM 



o 
o 

en 
ui 
o 
<i 

r 
<r 
a 

cn 
ui 
h 

3 
-> 
2 



— * ( I 

«i <i <x 

QUO 



coioo)0)a)0)tn_i_i_i 

aaaaai— r- <x-c<i 

jjjjjo.oeoo 



-i -i -i -i -i -j -i 
<t <t <t <r « « « 

Q13U OtSUO 



o 






en -i 

a <r 

-I (3 



_l _l to CO CO -I 

<X <x A A rs4 <c 
O tD _l _J O O 



u. 
u 



OOOOCMCMinOOOOOsSOOOOHOOinOIOOOOOmtOO.sOOOOO'VOOOOinOOOOOiiOOO 

h h to toooo in cm h o<f no mo o is oo nooo cm o 

o co to m o o o in o ro in m inn naio* o * 

©on cm »h •rtT^iswoo i-i c v m cm h in 



CO coco 

ce ce i t i 

a. a a. o. o 

z cc _i _i 

co x« z t- t- 

« o _i m o a 

a A A _l A A 



CO 

Ce -I 

a. a. 



MQ2 

uco 



CO 
CC -ICC 

a. a. a. 
a. a. 

ce 
a z ts 

<I w <E 

A _i A 



w I- to 

-J fl£ C£ CC _1 

ii. Li u. u_ u. u. 

Uu.Ci.il. 

•X u. -I -I 



a. 

^totorotOierototo - /i;£w 



I- I- *- _l k£ O _l 

ce fit a ce ce ae ce 

0.0., O.t-1- Ul . K 

ii ii O O © OhO hhhih ^ .■* 

rrorOtOi£i£:£tOtOrOrO 10 ^ 

totorozzzrototoro z to z 



Ziosot-i-o zrorotorozrorororozrozronrj v, i -• ■ 

w3<r<z<ioo33coooo<iuoou<ru<iuoo<i<E«oooo«<Eo>-«>- 

jiaaBiiianNi-iiiEi-EErthts-itEn-i-riirNuii'ihn 

OCiHO-^TOOOO'VOrJOOOOOIiTOOOOOOOIiTOOOOOOOOOOOOOOOOOOOOOOO 
OOIOins3intO© ^■OtOOO©©in»<s3©OfOOOinis O OOOIS 0> © O © O O © to © SlOO 

to isrs^o riinHOoeicn <ooc in cm cm co o ooocn ooo © ro rs «r rsoo 



ro o 

10 



CM to rs CD «0 CM rt 



h in to cm 

S3 CM 



to ro in 
cm in 



~ o m 

CM •* 



OCMO©00000000©0©000©000000©OOOOCMOO©OCMO©0©0000©©©000 

111 



OOOOOOOOOOOOCOOOOOOOOTOOOOOOOOOOOO^OOOOOOOOO 



X o ^o o o o 

t- 
« 

Ul 

a 

CC CC <IC CC CC CC CC CC CC CC CC CC CC CC CC CC CC CC CC CC CC CC ' ' ................ ........... 

NNNNNNNNNNNNNNNNNNNNNNaOOOOOaOOOOOOOOOUOOUOOQOSOOIS 

CO HMHHHHMMHM-HHHMMHHHHMWH*»«***»«**»t» • . • • . 

CO SaQSaOBi3i3C4aiau&5fii3fiQuiJfilLli.lLLIi.li.u.!Lli.lLlLLL.lLLlLLIi.U.li.lLlLlLlL!j.!ilLlL 
« wi-ii-iMi-.i-iwi-n-.i-.Mi-.i-.wt-.i-.i-UHMi-ii-ii-iZZZZZZZZZZZZZZZZZZZZZZZZZZZZ 

_i xxxxxxxxxxxxxxxxxxxxxxoocooooooogocobcooooooocoscs 

U OOOOOOOOOOQOOSQOQOOOOOZZZZZZZZZZZZZZZZZZZZZZZZZZZZ 

xx o uiiiuuuiuuuiiiiy • a co to 

WW » OI-Khhhl-KI-l-hll)(l) JS a U.U. 

x x i 2«<n<t«<r«ii<t€<!: ♦ _i <cc<ccococococococnccn<cco<E(ocoM zz 

aoxwcecececececececececeosotn Mww;3r)33333w3i-i3w333 

Ui Ul OZ>-l-l-l-»-l-l-l-K!- ♦wOUiZZZOOOOOOOZOZOZOOC coco 

>- hk XT3HMWMMHHHHH222ZhOGCii:4i£Ka:i!:ii:oiOicai(i)CH co 

i- w m OAU.ZZZZZZZZZZ «u<iiiuGaBfii3firu£fiiQujafias zz 

ii acocaao: jjOHs:trt>>->->>->->£>-j:>-i:>-> uiuiuiui 

a ooi->i-'uiQCiaooooooooo<t<xa:zo<r<i«xxxxxxx<rx«x<:xxcowi-'i-ii-i toco 

o jJuua.HHAaaaoaoiafiaHHO<[j zzzzzzz z z zztnu.u.u.u. uiui 

x x i <x « ooaicicaeuiujccicicic^ aiwtn(n«<c«'ii<i«<i<n<r(n<iw<t<iuiHHHH to en 

X CJU 2«<i:<I««««<tiI<[«<IUU'jiiU333 33 33 33 Ce3333DDUI<E« 

O OOUUUI UUUUUUUUUUI-l-QO 00CCC«<:C<[«0<C040<«iC0GC!Z00 

CJ L A.H H Q CJ (J <C^HH ELCCCCCHHWMHHHCCHCCHfliMM 'rHHHHt-IW4 XXX 

>->-xxoi-tMoooaooooocs:rxx3iaaozzzzzzziazi5Zi3Zzz_i_i_i_ia:fleiir33X 
iiooctLctaotLCiLCiicaiCLC oo>-<>>->-oaoaaoo>-ovo>-ooo q(lihhh 

as:ai-i-i-i-i-h!-i-i-i-i-hHHitii:Biiitirrriti2irii£onfKinj£tjjj 
^^xxj-wi-ii-ii-ii-iMi-ii-ii-ii-ii-it-txxuiuiozzzjrzxixxrxzxzzzxzccoooQxcouuiu 
uuuuxzzzzzzzzzzzzooa.u.tn<i<i:<3:<x<EC<ic<c<c^«c<i<£'C<i<]:uuuuuucjxx~ 





to 




OOlflrtM CM 


o mm 


n 


•«r to 


to •*■ o <r cm cs is ri o> o to ss o 


tso>T«cMcoomos30srsm 


H 0^ 1 


in-oo^o 


Ch to rs ii is 


o 

X 




1- 




n«HMMM 


MOO 


CM 


O h 


M 


C J h h O CM O 01 M H O O H 


CM CI .H O CM W O h O is cm cm w o o 


r-i o n i n 


ri r i h ii o 


X 




z 


ul 


N w S. "S N 


s. 


% N 


s 


S. V 


X 


WSWNWWW 


VV-sS.XS.VS.VX'S'S 


V >v S. 


S s, x v X 


V s, S. >» X 


o 




Ul 


1- 


O IS H IS CM CM 


~* 


il il 


•fH 


«TM 


n 


h S3 is ro ui ri m to o oo ii «r 


in<ry3ii3'Oiin<raO'«vi]i 


O ■* is 


o O IS t> o 


S3 S3 N IS T 


o 




a 


<r 


h OO O O O 


o 


11 T-t 


*H 


O H 


i^ 


OOOOOOOOhOhO 


OOOOOhOOOOOO 


h O O 


Tl 11 O O ^ 


o o o o o 






w 


a 


s. S. \ «s s. \ 


V 


s« s. 


N 


s. \ 


N, 


VNS.XS.KNS.VS.VN 


•SXXVVNNS.V\XV 


V V V 


S. % N V X 


N s. s. v -v 


a 




U 




nninvtoto 


CO 


V V 


rs 


<r to 


S3 


s3s3rstOS3tss3s3COtO^-UT 


rsiss3oocDs3'<rms3uT'Om 


rscorosstsoocoto 


is oo m m is 


z 




z 

11 




rs rs rs rs is rs 


(S 


is rs 


rs 


rs is 


IS 


isisisisisrstsisisrsisrs 


isNisrstsrsrstsisrsisrs 


IS IS IS 


IS IS IS IS IS 


rs is is rs is 


<z 




z 


j«oo«« 


« <t « 


X 


Z -1 


<izx>->oo-iz«xa^ 


ouix<CN>io:x<xxax 


o_i<izxcea_i 


«x x x « x 


CO 






o 

H 

1- 


U, OX X oo 


M 


OO 


o 


H P-i 


3 22^^£2<II-UI-IIIOUZI-h{ZOI-3 0hI-U1iL 


Mh«IU.OI-l-OI- 


to 
<z 

-I 






o 

o 


COS- 3- 








a 




a 


a 


o 

0. 

CO z 


o 

o 


CO 


o 

> 






-J 


Ull- t- 




<r <r 




cc 




-i <r 


-i 


3 


ac z 


Ul 


a 








JMH««< JJ 




o 


1- 


3- Ul Ul Ul _l Ul 


Z> ui 


1- o z 


a _j <c 








h- 


O UIO o z z to 


-j -i 




u. 


n 


H HKI-2JJJ 


o. o ce ui 1 


« 1- 


ozuoo 


ce ui z 


a 






z 


i- o <r <r 


o 


M n 




cc ■*. 


Z 


ace u.t-i-«ii<i_j 


OZOXI-I-OZU. ^ 


o o 


Z « -I Kh 


<x o o « 


Ul 






Ul 


z z to to 


o 


x X 


z 


3 Z 




K_iuiaoouizxauiz 


4U0KHHUJH03U 


a z 


<I O 1- tO h- 


1- u. Z O 


H- 






a 


ui <r <t « <t « 


_] 


o u 


t-H 


K <X 


u. 


nuiao:z_i>-iiuuixo 


i-tni-xzo_io_izoo 


X <t w 


a m i- ce ui 


2CCI- <I H 


ce 






n 


x to to i- »- 


<I 


3 3 


<I 


<£ C£ 


_l 


>SHH«H£<[ii:32UC 


Huitni-uiijea i— h u a 


«o. z 


uiMur 


«X Ui « to 


3 






U 


_i to z z zz 


i: 


o o 


ct 


U U. 


_l 


au. jnk<ilo:ozh> 


3 cc 3 z oi-zaLCCetoa 


Ul £ 3 


_i ce _i o _i 


_i _i ce cn ce 


to 






z 


<o««<« 


en 


X X 


o 


Ul 


Ul 


4Z <Ii.IHIIUH3 


ceui0nxuiui_i<ca.03 


t- <z a 


o <r <t 


H- 3- 1- O O 




o 

CO 

0- 




H 


0. _i ^ ^ to to 


o 


o o 


-i 


a 3 


3 


aui3Xtoo_ixo^:xts 


u.ox30.ao.oxtoz_i 


to i- a 


3 o z X 0. 


•« 1- 03 _l O 


Ul 

ce 




o 


o <r <r <r <t a 


<r 


<x a 


N 


<t <i 


O 


<ZO««<Z<t<Z<I«<I<t<X 


<t<t<i<r<t<t<t<i«<r'«« 


<z <r <r 


<i <r <r <r <t 


u. <z <x <x c 


»H 




z 


o m »h rn rs is 


-0 


n n 


CM 


> ri 


>T 


cm <r t o- m 03 cm o h r-i o r j 


n o- 1 »• m -o o m i n m <r 


ss o rs 


h m o os ss 


rs «■ ro n to 




1 






ss in t«i o is is 


N 


«r «r 


r-i 


0> O 


0> 


oo S3 ii m cm ii cs m o co ^- cn 


n i h iii i «r oo -o n oo o> -o 


S3 m S3 


hO0>»< 


flKT *< 


to 


m 




i- 


hot »nn 


»-< 


to to 


'T 


ii n 


ro 


osDmsjrsrorocMCDfoross 


m r t ch rt <r h m no n t m 


ii CM S3 


S3 ii IS V ii 


is »r ts cs to 


a 


y-t 




ce 


o o o o o o 


o 


OO 


o 


o O 


o 


OOhOOOOOOOOO 


HOOOOOOOHOOO 


ooo 


O h O O O 


o o o o o 


ce 


1 




o 


h oo cm to ro ro 


(M 


*1 *H 


1-4 


m t 


^H 


riNrstos3mro«rH03H<r 


S3 m UT S3 IS CM M O (0 00 111 O 


h m is 


h O CO O h 


is oo rs is m 


o 


z 




0. 


H oo o o o 


o 


il H 


iH 


o o 


o 


OOOOOOOOihOhO 


OOOOOhOhoOOii 


woo 


^t «1 O «H ii 


o o o o o 


o 


-> 




Ul 


nniovooo 


to 


«r •* 


IS 


* T 


IS 


•os3istos3rss3s3a»ro»ruT 


rstssscDoo-ossmssmssmisasrossiscDOOtoisoouTmis 


Ul 

ce 



-168- 



Ul 

a 
o 
z 



xxxxa.a.xa.xa.a.a.a.a.a.xza.a.a.o.xxxa-a.a.a.a-0-xxxxxxxxxxxxxxxxxxxa. 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxzxzzxxxxxxxxxxxxxxxzxxxxxxxxxxxxxxxxx 

inininininininininininininininy>^inininininincB>o>ooob^inMiininnin<inininininininob^invincMin 



©ooocMOOOOOOOOOOOOoooooooor-ioooroooriooooooodnonoorifjo© 

CM CM CM CM M CM CM CM CM 



© O CM CM CM CM CM fv rv CM CM CM CM CM CM fv rv IV (V CM CM IS CM CM CM fv N rv rv CM CM rv CM IV N rv IV fv CM IV CM CM CM CM CM f J CM CM CM (V 
CMCM CMCM»«»<CMCMCMCMnCM»«»«»*.«CMC,|»«CMCMM o o »» CM CM o ,*.<,* ,h o „ f\| CM CM CM «* 



ce 
ui 

A 

£ 
Ul 

o 

Id 

a 



ce 

I 

H 

r> 
rv 
o- 



_i i- co _i co _j _i 

<I U. CO <X A <I <I 
UUJOJQI9 



U. U. U. U. Ll. U 

u u u u u u 



JO) hht-l- 

<r n u. u. u. u 

O O I'UUU 



H _l 

a. <r 
u a 



-J-l-J-l-l-l-l-JW-l 

<t<r<t<t<r««<iA<t 



000000-000000000 

© «■ o o rv © m o >o o o o »< 

o a o in r<i » a n o> o 

»<>onBoiiOH ro t»j co 
— to 



©OOOOOOoOOOsOOOOOOrOOOOOOOOOOOOOOOOOOOO© 

~ © o ©in o ocooooocooo 

o © o ♦ cmooooopoo 



o iv o o o 

~* r i O O O 



•o© in cm 

CM 



-O 00 
CM 



in co o- a- <r c>o 



2 « Z 

« « I- « 

I- W F) t- 



ce ae -i -i 

I- W- K t- 

— r z 

* * n 

z z ro _i <r <i _i _i 

<I<EO<t>-<I<t>-<t 



O O O _l _l _l _l _l _l _1 _1 _J 

ce oe ce ce ce ce ce ce oe ae ce ce 

yUUhh h- W KK I- I- h- 

ie <t <x <t o o o o o o OMOOO 

Z * ^ m x * ^ xz^nnnzniiiiznrtrtiiM 

<£ZZZZZn««z<t<tZ«<lZZr)nr:znro2Zpn — 



*: _i .e 
ce ce ce 
t- t- t- 



w _i<r<t_i_i «zzzzzi'i<i«2««2««zzi , inK2nnzzi<ii>!nni l ) 

u<>-««)-4 _i<r<t«<t<iu««<z<i<r<i<i<zc<t(_!uu«uu«<E(juuuu 

ZMunnuoiaitauuui-i-innt-niihnMhi-zrii-izhhiiirr 



..i«nz ie 
nnnzpiz z 

<L O <t > <I 

I- Z »- M H 



oooo©ocM©>oo>osODOoo©ooo«H©oinooo©»<oo©oo©on*-©ooooooo©©©o©© 
o oooommw-o-ovoo^ ©no^oo-o^oco oo cm o o o © o n co m 

o in o *• o »* o o> oxsxoon o o «o -o * « « © too eo oo »« 



T O O -0 O CM 

M M h »• -< 



o o 

o o 

CM 



o in -« 

IV 



oo* »»<r*> o cm cm 

O CM 



IV o 

ro o 



** OOOOOOOOOOOOOOOOOOOoOOOoOOOOOOOOOOOOOOoOOOorvooOOO© 

3 

"J 

Z 



z 

UI 

a 
►«« 
u 
cj 

<I 

oe 

•a 



00000000©00000000000000-«00000000©000000©©00*-o©oOOO 

OOBBBOBOBOBO 

U.U.U.Lb,L.lLltlLli.LU,l9DDaOOOOOOOOaOOOOOOOOOOOOOOOQUaUUO(30aO 

zzzzzzzzzzzz 

oooooooooooo .................................... 

ZZZZZZZZZZZZIi.U.U.U.U.U.ll.U.U.U.U.LL.U.ll.U.U.L.U.U.U.lLU.U.b.b.U.U.L.U.b.b.Lli.L.li.lLll. 



o 

ID 

o- 

I 

in 

z 
<t 
"1 



z z z 

3 3 3 



III UI UI 

XXX 

0Dh» 
O O »h 
S N N 

IV oCO 

© «■<© 

N X v. 

rv m rv 
rv iv iv 

<r * a 
a. o z 



z z 

3 3 



UI Ul 

z z 



M OB IV 

O CM CM 

V. N V. 

O V CM 

o OO 

N V N, 

CO IV 03 

iv rv iv 

z cm 

*- *z 



X oooooo 

ce. u. u. u. u. u. u. 

o 

3 en to to tn to tn 

_l oooooo 

U. Ul zzzzzz 

<-■ a 

fill CO CO CO CO CO CO 

OX ui Ul Ul Ul Ul Ul 

ce o uiuiuicocotococoto 

oz zzz<r«<t«<i<tLu 

_J Ul CO uiUIUOOUOOUZ 

XZ03ZZZ_I_I_I Ul 

3uaouiuiui>->->-cececececece_i 
>-ioceoitatDt3i-i-(-u.LLa.ii.o.o.>- 

JZHI->->->UUUIZCIZZI 
UIOi-imXXXUUUOOOOOOK 

zxzzoao<r<r«(jcjutj(juui 



cococotocotocococococo 
<x<r<i<t<t<r<i<i<x<x<i 

oooooooaooa 



z z z 

O 3 3 3 
M III W 111 
t I I I 

a o o 

ZZZZZZZZZCecete 

LUUlUUIUlUIUIUIUll->->- 
OOOUOOGGUUiliiUJ 

ooooooaaoj-u-u. 

CtCCutCCCCCCiiuiCC 

aaaQaaaaaocscs 



CO CO CO 

<z <z <r 

C3 C CD 



rzzzrrzzzzz 

333ZJ3333333 
UlUIUlUJUiUlUJUJUJLJLJ 
_I-I-I-I_I-I-I-I-I-IU 

ooooooooooo 
ceoeceueLCCtceceucccci: 

^— H-h— ) — 1^1— t— »—►—•— t— 

LUUlUlUJUJLJLJUJLJLULd 

U.U_U-U-U-LI-U.U-LLU-1J_ 

oooosoGoaso 



ZZZZZZZXZ_I_J 



CO CO CO CD CO 

<r <z <z «x <r 

eoaas 

z z z z z 

3 3 3 3 3 
Ul Ui Lj Ui UJ 
I I I I I 

o o o o c 

ci ce <£. ct cc 

>— t— i — i — ►— 

Ul UI Ul Ul Ul 

u. Cu Ov u. Cu 

C C3 □ G O 

_1 -I -I -I -I 



OKO*HOOcoNNNCMCMnwcMvo»<^om©voo<o»CMNr>i©ooom»o»oso©c*rgi*>N»«in»< 

h n h h x h n n n X n m n « o - o n ri fi h ci h o - fi N n n o h h o - - n - - n - o n f i n 

VVVV.VV.V.V.V.V.NNV'VV.XNV.V.NV.V.-VNV.^XV.VV.VNVV.N'VNV.V'VXVV.^ 

wMrvuiuirvovo>>c<iriooo«iv>oriin»HC>io>ninin»4»CM»o^«-i-HwO'-i-<»<CD-oririoO'-<n 

OO0OOO0OO'-<«h-»'-«OO0OO-<0OOOOO0'-<O'-«-<'<'^O»h0OOOO'-xOO'-iO 

>vN'V'V , VV.\V\NNV.NV.V.SV>V,>yV>V^V>vV.VV.>vV,V.V,V«NV.V.V.V.V.NV.N v \XV 

rvuiv-o>oivcoaja)in^»*cocovmcO'0^ninuTa303*in^for , iinviniiTrvcDivy)fvfvivcocoM3 
NrvivrvivrvrvrvrvrvrvrvrvrvrvrvrvrvrvNfvNivrvivrvrvivivivrvrvrvrvivfvrvivrvivfvNNrv 

IX^4«J^^D>->-XKJJ(I)ZZ1J«I-NUZ<O<4U(0OO«UOUhv«h«<[U 
at-OCwCv>-4ZZZ33l-K>-i>-iZZ>->Zi-<UUNZMUUU3Z^ZU3ZUZZ3UZUUZ 



>- Ul 

I- Ul CJ 

KMMJZ 

uiOMjy 
01 3HK^ 

ce ui o 3 3 ce 

ui co _i x <r « 

£ >-• O J3 
O O H Z Ul 
(OBOI^IZ 

<x i <i <r « <r <i 

•nnOTrt'Oin 

n ut -o w »r en in 

ivoocMOKvnMco>- 

ooooooooooo 

0s V On O in V CM *• IV 111 m 
OOOOOOOOOOO 

rvrvrvo)ivoDtvin* , <os> 




z 

m 

o- 
<I 

-1 
u 

V 



c 

CJ 

Ul 

ce 



-169- 



Ill 

•c a 
n o 
x 
bJ 
CD 

<r 

a. ce 



ii4.i.4.Lil.6.u.u.ii.lLii(i.i.iu.S.4.ili.il.i.4.iIiLlIIIi4.iIIiIIi.[Lu.iIiIi.l. 
I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

-o iii th m w in m m in a. -c o -o m m <i in m -o -o in -o -* m m in in in in in in -o m in in m in in in in m m in w in m ui n n -o 



©oooorsooorsooooooooooooopioopiooooooooooooooorsooooorso 

~t ** PI PI <H «* 

c-i n rs tv rs pi rs pi m pi pi pi pi rs tv pi is rs ri pi pi pi pi pi pi pi ■* is is rs n rs pi pi pi pi pi pi pi pi pi rs pi pi pi pi pi pi m pi 

P4 PI * t4 ih -h PI Pi PI PI *H »H »h th CM CM PI CM PI PI Pt «« *4 ■* «H -« »< PI pi PJ CM Pi CM pi PI PI ■* Pi PI PI PI PI PI 



in 

lZj 

oe 

CO 

rs t- 
o x 

oe 

Ul AC 
A Z 
X •-< 

u <r 

o i- 

ui z 

a a 

u 

3 

oe en 
x ui 

M X 

IS <t 

cn a 

CO 

> ui 
_i >-• 
2 ce 
-) x 

~) 
o z 

z >-> 



-J -I 
<I <t 



-I -I 

«<£ 

cdcd 



-i_i 
cs o 



_i i_j i_j i_i icn 

<t<r<r<r<i'<r<r<rN 

CDCDCDOCDOCDOO 



co_i_icncncncn_i 

_JCDCD_l_l_i_IC3 



_l _! CO CO _l CO 

<x <r p- »-- <x a 
C3 C3 _i _i CD 



pi'«rooo©©©©opio©oo©oo--]©©oo©©o»«oo©©oo<-ino.-)ooinoooMM'<ropi©© 
o piooo o o o o co © © -o ooo in in ^ -o o 



-i -i 

oe ce 

H I- 

O "i o »■< 

ro m ie n ie m 

m m z m z m 

U U <E U <I U 

X XH X l-X 



PIO 

0»»* 



o o 
o o 

in-H 



ooooooo 
o -0 o -o rs i* © 

»H -H «H CM »H Pvl »* 



oo 

in ■» 
pi 



oe 

i- 

« M M Z 
ffiUUC 
*■ XX »- 



oe oe 

ie ie 

z z 

<t <x 






ie ie 
oe oe 



CO 



oe oe 

o. a. 

a. a. 



-e -e 
ce oe 
t- i- i- (- i- 

-■i -h O *-* © © O © *h o 

rtflZflZMZMMMnflZZSM r-j n w 

uu<ru<ru<Eouuuu<i<Eacjuicjcj3<Erso.rtisrsrs(sisNrsrsrs<i:« 

iii-Ei-rt-irriti-i-TEfunhMUNnMWrtrtrtrtHdisai 



coce 

_ii- a. 

o o ie >- 

nnozo.zu<c«<EuiuiiiLJiiiuao 



-i 
i- 

X 

X 
Ul 3 3 

p» ce a 
»h a ^ 



uTOOTOorsoooooofl-OMOi-ioooooocooocooeociooooooooocooooooo 

<h O O •*■ © © -O M © O CN Pi COO © O © O © © O O'-i OO OO OOP! o ooo 

rt o o n in in o oo ro no omoooo© ot oo »< o in in in in pi mm 



moo «H 
»-.pi 



--i O CO «0 
O «-* «-( 



in m in «o -< o pi 
n th n pi mh 



pi o 
pi 



11 »H »* V 



z 

Ul 

a co 

w CO 

« 

U -I 

1 CJ 

oe 

« 
-i 

3 
CJ 

X I- 

UJ i-i 

=► a 

o 

C3 X 
Z X 

M O 

2> U 

-I 

o 



OOOOOOOOOU1PIOOOOPIOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 



OOOOOOOOOWOOOOOwOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 



<fiaAffittffiAanAifiSdaAffiffiflfiAffiffiffi 



ooooocsoooooocoaoacocsaaaooocscsococococococococococococRcococococococococococo 

HHMHHHMHHMHMHHHHHHHMMHM 
a * *■■ ^ a ^. — .. — _ . . .* . . ^ . ~ ^ — — — ^ — » — — ^ ^ i"» i"^("^^™i^»(~^/— i^^ri^ir^i^^r^r^ir^;^^^!™! (■■( ^ f™ : 



U.LIl.ll.ll.lLL.Il.lLli.lLLLlLlLLlLli.li.1 



oooooocooooooooooocoocc 

Ll.LiLLLLLELU.Q.U.U.U.U.LLLLU.ll'i.ULLb.'iU.J.i.'i'ilu.U. 



cococoeococococococococo 
<t<i<:<t«<E<E<E<E<i<t<r 

OC3C3C3C30C3C3C3C3C3C3 



xxxxrrxrx 

3X33X3 333 
biUIUIUIUiUiUILJU! 

— i — i_i i — i_a —i— i : 

ooaooo ooo 
oeoeoeueaeoe oeoeoe 

K- I — I — I — !— I— I— I— I— 

UIUIUIUJUIUI UIUIUI 

a. a. u. o. u. u. a.a.0. 



XX 

3 3 
Ul U! 
-I -I 

a a 
oe oe 
i- t- 

UIUI 

a. u. 



QOOOOOOOCC5BC 

I I ^ — I I ( 1 I I I I I 



en co co en co co 

<r <r <t <t <r <i 

C3 a co co a a 

x x x r x x 

3 3 3 3 3 3 

ui til iii ui ui ui 
i t i i i r 

ooaooo 

ce ce ce ce oe oe 

1- I- 1- K K H 

ui ui ui ui ui ui 

li- U. LL li- U. U_ 

o a a o a a 

_i _i _i _i _i _i 



co co co en co co co 

<r <t <l <r « <r <z 

a co cd co cs a a 

z x x z z z r 

3 3 3 3 3 3 3 
Ui Ul Ul LJ Ul Ul Ul 
E i I I I I E 

o o o a o c o 

ce ce oe oe oe ce ce 

(- K I- I- 1- I- l- 

Ui UI Ul Ul Ul Ui Ul 

o. a. 0. Ol Ol u. u. 

a a a a a a cs 

_i _i _i _i _i _i _i 



x ui 

en z a 

<t <I M 

o x 

ui o 

z z oe 



s B oe oe oe oe co 

m li Ul Ul Ui Ul I I I 

3CS_i_i_l_i_iU!Oao 

OHOjjjjfincnto 

H JlflHMHHH 



Ui X Ul 
_l <L I- 
O _l 

Lt > Z 

I- X Ul 
Ui i- cs 

0i_ Ui o 

z oe 

c w !— 

H|2H 

_l I- Z 



i-i CJ U 3 3 3 3 

u « <r 

u u 

u ih i-i oe oe oe oe 

M J Jhhhl- 

z o a 

Uiujaju.u-u.u- 

to oe oe z z z z 

oe c « o o o o 

<£ CJ CJ CJ CJ CJ CJ 



o z 

z >- 

3 U 

IH 

CO z 

CO 3 

<t li 



z z 

<i <r 
v > 

U CJ 

z x 

3 3 



3 3 3 3 3 

i 1 i i i 

O O O O O 

co co co co cn 

i I I i ! 

c o o c o 

z z z z z 

ui Ui Ui ui ui 

X X Z X X 

u-u.u-u.u_ 

o o c o o 

u. ce oe oe oe 



ui 



co 



z 

Ul 

a <z 
w s 

CJ 

z 



3 3 CJ 

> >- a a 
ce oe w w ui 
aajjo 

IH 

ui ui ui ui z 
a a c a o 

NMH h i; 

cj cj cj cj a 

HHHM 

I- t- K I- _l 

CJ CJ CJ CJ > 

Ui Ul Ui Ui X 

cn co cn en i- 
z z z z ui 

HH IH W M e 

>o o co cd pi is o* n co o- pi pi o rs -* >o •h co m o- co o- pi co > is ev- m co pi n co co o o cs <o o o- rv rs r i m pi pi m o w >o m 

H M -H -H -H O H -1 O PI 'rt •« fH PI M O i* -H PI CM PI PI O PI PI O -h © iH o PI PI -* M M O O iH O PI Pi PI Pi PI CM H -H »< O O 
XW\w > >^> x > >i - x \^v.S.\XS. , V\VX\VN v VV.N v VS.S v V > sS.VW\VS.X\V'S'S'SS,V'S'S'S 

co n n ^ n n in rt h <r ri ri h -i o « h H o <r h <r n o o < o o- mi »• »■ rm m h ui n i-i ri n <r iii -o -o h v r-i m o 

O-hOOOOOOOOO-h^-hthOOOOOOO^^^O'HOOOOO-iOOOOOOOOOOOOOOOO-i 
■S\S.S.S K vv.WN.S.\XWVXVSX - SS - S , S\S v VVV\\NN , SN > s , SS.VVSS,> s > v S.N\\s>N v 

>o<ininuoinuo«o^ui<)<MMMv^^rsp.coNa)rsNmmMUT^uTMrsa.cDrscocois^-o^^rsismmNiioco 
rsrvrsrsrsrsrsrsNNisrsisNNNrxrsNrsrsrsisrsrsisfsNrsrsrsisNfsrsrsrsrsrsrsisisrsrsNrsrsrsrsrs 



i— & a a z 



o o 

a. co 



o a 
co cn 



z z z z z 

a a a a a 



z co oe <: z •« a _iazx>><t<:z<too<i>-<:>xoeoNxxxxcoxcn<E<r<EZoe<t<r'<i'«cncoco 

O C«JHii.£H|0Z|-33HlZOUZQ3L3O<Z<[OhhO^I-^UU-,l-Oi33J£ZZ 

HI 



<c<£<EZoe<z<c<x^cocncox-joecnu 



") 



X 

ce 3 

Ul <L 

z ui 
ih a 
ui o 

3 x a 

Ul I- IH 

ce -i x 

0<Ch 



Ul 

-I 
_i cez 

HUO 
5NI- 
Z « X 
T CH W 

a u. <t 



cn 

coce 
zui 

IH I- 

3 oe <t 
<r a. 3 

Ol CO _l 

-I 
31-m 
«Oh 
0. X CO 



CJ 

z 

CO 3 

CO ~i 

<E 



Ul Ul o 

J JU 

O 3 -J 

<£ O <X 

Ul U3 



♦— I I 

Z Ul Ul 

ui cn 3 

ih cn co 

oe 3 o 

o oe ce 



-i 
-i 



ui 

a _i 

« z <t 

> co v o a 3 
zo<xzzcnzo 



a 
<t 

Ul X Ul 

i- IH z 
CO Z Z Ul 



IH _> V 

u«zu 

ih o z a o 
z oe en z z z 



zo<xzzcnzo enzzui zoeenzzz 
•xz3xouooeoiu-uio_i030iHUicncn 
a<cjui-zi-a:u.zo-: ou o a. a .. ui ui 
_i_iuiiHu.ououi<xx-£a<zcez<i<i:oeo£ 

<r<XuJu-CX<ISOIu.<I<I3ULuir3u.u. 



oe 

CJ 

-i 

_i cn 

« IH 

X X 

cn u. 

u. z: 

z z 



>.e 

ijj ce 

_i cj <t 

-j -i 

■4 CO _l 

3 J « 

_l 3 
Z <I 

<I X <E 

a cn _i 

li. u. _l 

O <E <Z 

-) Z 3 



<r 

_i v > 

_1 I- K 

<t IH IH 

3 ih CJ CJ 

Z 
<X UJ o c o 
junoo 

Jli J N N 

<t u. u <i <r 

3Ulffl>> 



co a 

3 ce z ol 

a 3 u <r 

z i- a oe >- 

3 <x o o i£ 

_J CJ i£i u. U 

O Ul Z 3 O 

cj a ih ui ce 



<r<z<t«<r<r<t<i<r<r<i<t<r<i<t<r<r<i<i<r<ta<t<r<i<r<r<i<i<r«<r<ra<iu<E<r<r<ia<i<t«a<raj<r<t<r 

Pi NOCS<HSDO.TtSCVMrsMC0<TC0IS^-HMI>-M<ICVC>-O'TCVOC0rHC0 PI CSO>-M<rCOMCOCOOOUTU")>T-0 PI C Tl 

^ocoH<lnn^»al^r•lOl^O(.orll^lDllla)nlf)rt<frt()•■•H^<rc.(tla)w<^^1-l(<)rl*tDrol , )«•^ltD^H 
OMism<rpiois-o<TouiMoo^T^oo^owrs«rq-NuTPio^ooPiO'H-H-opifl-<icocoPi-o^i-io^<r--iM 

OOOOOOOOOOOOOOOOOO-h-hO'HOOO'H'HOOOOO'H-^'HO-hOOOOOOOOOOOOO 
O r* N vo CM PI -O »H »-i CD M PI -H PI PI CM PI PI CN UO PI Ul PI »* -^ -O O CK CO in O O Pi <T «T ^ 111 <T »H M M m UO rs rs Pi UO M T tH 
000000000000«hwOOOOOOOO<h»<-hO»hOOOih--iwOOOOOOOOOOOOOOOOw 

sjrsuoinuoinin"0 , oinvjfsMM*^v^rsfscBrscoisiso.cDM-i^inMNCDCorscocBN>o>o*vrsrscooa 



o 

:c 
z 
o 

CJ 



a 

a 

Ui 

h- 

ce 

o 

CO 



-170- 



IS.iiia.itIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIi.IIIiLu.iIII 
I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I ! I I 

zzzxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



ininmininininininininininmcjininininininmin 



i m in in in cm m m in m 



OOCJOOOOOnoOOOOOOOOCMOOISOrsoOOOOOOOOOOOOOOOOISOOCIISOOO© 

C J CN ** — H CHH 

(S CJ M CM N CM C-4 CM CM IS C4 IS IS rs rs CM CJ CM CM CJ CJ CM C-4 «M IS CJ IS C4 C-i rs rs IS IS IS rs rs N IS is. IS IS O rs rs CJ IS CM IS CJ M 

«H C-4 ** CM Ci CJ h fl •< h »( »< M N M C4 CM C4 »h CJ .< Ci CJ ~ ■* .*»*.* »* »h .* -i n rt »h i i-i ^ N « C4 f-l 



3 
-) 

O 

z 
1-1 

a 
en 



Li 

a 
l-l 
o 
u 
<I 

ac 

<t 
_i 
=i 
u 



CO 


en en en 


! 


a 


AAA 


<Z 


_i 


— I 1 1 


a 



_i en _i _i _i en 

« N <t <t <t 1X1 

o o ts a a _i 



OOOOOOOOOOI-IOOOOOCDt- 

o in co m o n 

<o on *-i 



■rtOOOOOOOOOCiOOOOOOOOOOOOOOOOOOOOCO 

m o o -< © in o 

cj o ^ n in in 

i* 



CM 



en _i _i en en _i en 

ct _i ce i- i — i i cc: — i 

i i i E I- i i \- i 

* i i -0 Ci 

Z _l C^OJ JiiJH 



iC fs 
z o 



I- CC I- 

r i a a r 



-i -i o a 

i-i- o o 

A X Z O O 



z -i z^o-i-i^-i^ zo t '^ u ui r z uz jizz zz 

<t C3t-03Zm>-l-ZI-t«l<IU<i:muUU3Zii3«X i<Xn3<Eo:X<I«X 
AAA_IQ«0<ECC«UOO«OUISIS_4U-«»H-<u£<t>>Ce_llS-5V_l<ri_J_IO_J_IO 
«-WinACJAAAAI-XAAI-AXr*>rtAZC4CJCJAI-l-h-AA-~l-OI-AiCAAAAAA 

oooisooomoooooooooomooooooooooooooooooooooooooorsooc 
©oocoooocsoTinot-i ©>oincjcj©oo oooo o© ©oooo n© o 

oom vino on* vnin o ow© mono in © o^m-oin ^ © © 



OC Of 

A I- A 

U. Ui U. 

_l 

X _l X X X 

O « C-i CM 

A i A ii ii 



-j en 

-4 OC _l 

i- i- a. 

z 

E X Z Z 



«HM*MCMM-4in 



cj m © 

>o 



co in 

C-4 



M »h©©0000©000000©0000000000©00©0000©00©0©©0©0©0©©©©© 

cc 

3 

-) 
z 

HI 

en 

Z O00000000000000000©00000000©0000000000©©©0000©©000 

I- 
« 
111 

a 



AAAAAAAAAAAAAAAAAAAAAAA • • • * • • • • • * • • • • • * • -<X<X<:<X<I<t<£<I^ 

zzzzzzzzzzzzzzzzzz 

(nenenenentncncnenenenencncncnencnenenenencncn • ♦ • • • • - ♦ • - • • •_i_i_i_i_i_i_i_j_i 

MI1»1WWI1l1l1l1l1l-ll1l1*1l1l1l1l1l1l-ll1l1l-l^^:^CC4C44C44444444iiiiiiiii 

OOOOOOOOOOOOOOOOOOOOOOO • • • • • ♦ • • • • • • • - • • • -XXXXXXXXX 

iiiiiiiiiiiiiiiliiiiiiiiitiiiiKliCiiiiiiiiiiiiJLlliililUlJiiJillii 



Z 
1 



OC 

o 
a. 
ui 
cc 



OJE 
-I ZZ 

o o 

UJ H H 

a z z 
i-t i- i- 
z <c <c 

O Ci i 
i <X <X 
A i i 



a a a 
z z 

UJ UJ UJ 
I- V- h- 

<x <r <x 

XXX 

i i i 

en en en 
o o a 
xxx 

i i i 



Z Z 

UI UJ 

I- I- 

c « 

X x 

i i 

en en 

o o 

x x 

i i 



a en 

M O 

3 Z 

a a 



AAAAAAAAAAACOA h- I- h- I- h- 

<r <x <i <i <z <z <r • uuuuu 

II) (DM UlOU) ««««« o o 

cncocococoocooacoo»o _i _i 

a a o o o z o z z c z z z uuuuu a. a. o o 

ZZZZZZ Z • UJ UJ Ll! UJ UJ XXOO 

QCCSCSSSQCCJJJZiiiLLi - • • • • • -U4U100 

i_,i_,_,i-«i-ii-<i-!>-ii-ii-«>-ii-ioao •enencnencnenenenenencnencnenenenen »* ** 

_i_i_i_i_i_i_i_i_i_i_i_icococn« .......... ..zza a 

•3333300000000000000 

zcncococococococncncncncncncnccooooo • • • • ♦ • • ♦ • • • • z z cn cn 

033333033333333 _4_l_l_l_IZZZZZZZZZZZZZZii 
UUUUUMOOOOOOCOOOOOOOU4 <Z <t <Z <Z 

mmXZZZZZZZZZZZZZZ-J • ♦ • • • -OUUU 

zzi-oaoaooaooaaooonxxzzzzzzzzzzzzzzz i i 
<t<E<Ecncocococncncncncoencocncncncn • ♦ • • • » • • • • • • • • • • <• o a h- h- 

00«MMHHMMMMHHHMHHU)«4«««««<:C««««C«4«Srttin 

iLC<iooooooooooooooi-i . . . . . . . . . . . . . - • • -ej:_i_i 

OQiiiiiiiiiiiiiiiiL£i£LCLCI£C£<XCCL£iJCCCL£CCCCCCCCC£<I<£AA 

CMI>>OMOOfl - 'HM0»*(sv~0O>-0'0C4CDOVUTMrstS(MC-4 0>0-C4 0~l>OCJC>CN-«P0mOO 
O fl h »< rt f U< h O •< N CM C4 CM C-4 NOOrtrtPirtOfiNONNOONOOrtnOOO-H CI CJ w 
VVsVvs.s.s.vs.s.NSV'sXS'ss.s.s.s.ss.xs.NVS.s.s.s.s.vvX'ss.vs.s.v 

n**-rtisrs^^o^^Nci(sricitsi*)fl'0-ocD<roc»>'r<'-<-rtCDco--»cocDn>HCDco-rt-<rtii-i>o 

00000000^000000«000-rtOOO»HOwOOOOOOOOOOOO-r<000 
s.s.VS.SS.s.s.s.s.s.s.nvs.s.nss.nnvs.s.vvs.s.s.s.s.'ss.xvvvs.s.s.w 

m<cococoM'r , oininn'Vco»oisrs<o>oiiT-<3fl-^->oiiTrsisuTUTinininiiTin»TiiTiiTUTUTir)!iT<r-J3 

NlsisrsisisNisrsisrslsNrsisrsis|sis(srs|sisisisis|srslsisislsisisrsrsisNlsisisN 

<tUJjjNjxK«9)4>-ili:JZi<iz>i-50uuuuauua<luouujx5i 
eDZ<:>-«<r<ti-'i-oiZiJC^ooi-t>-ioii-^u3uzAoi-ii-"ai-i»-iiOwi-ienu.i-3z 

i u 

3 Zh- UJ 

H O 3 UJ Q 

Z<C _l ZZ-I zz 

<t CC Z O JQ33UZOO 

I- UI ZAO UJ Z h«OOh|-I-I- 

QZU4 Z<£Z =>UI<X MJhhirQQ 

zoo ui uj o d:_izcnxujzo zz 

H£o«H3iiz«t-a:iiiOii:uj«z>-MH 

lODZOHGlUlOMZWDhyiuOHZII 
ZC»)0>01i£UiJDI-liJJOOuCC CC.U <fl to 
^UiOM'IOOwijoo _lwOO>-iOiO«<r 

_iAzt-xenzcc<ri-Z3uzci:zzzcncc33 



>- >-> z zz 

x x x <t <£ <r 

t- t- i- o o o 

UI U4 UI OC CC OC 

z z z o o o 



rs ^» v* 

O CM O 
V s. s. 

CM <0 0* 

^ o o 

s. s. s. 

+ Fl~0 
IS IS IS 

«JO 

a. ceo 



Hi t- 

l-l I- CC 

u. en cc i-i 3 

CC Z UI 3 OC h- 

«hhOllJ<r 
UHZ Jiu 

_l Z 3 O O U4 

u co en o cc a 



z cc 

O O 

« I- >-l 

Z <t tC 

o n u/ 

_1 O i 

O _l 3 

u u. en 



en en 




CO (0 




cn en 




_l 


-I-J Z -I _l 


Z _! 




_l 


_l_l o 


JJZ 


o 


_j 


_J 


A 


HS 


<t <£ 


>- 


<E <X 3 I- C 


« 


-J U. 


3 


u. u. 


o 


U. U. O 


o u. 


I.L 


_i <r 


z en a 




Z 


1— 


z 






UI 


<L 3 _l 


oo 


1— 1 


o o en 


t— f 


o 


o 


3 Z 


z o u 


X X 


X 


X X i 


X 


X 


I 


Z w 


UI _i ►-■ 


<r <i 


en 


<r <r ui 


LO 


<I 


<x 


CH U 


j ji- 


UJ I-i 


<t 


u u > 


<t 


1— 1 


Q 


<r _j 


O UI z 


I-I I-I 


3 


HH I 


3 


1— 1 


l-l 


A UI U U. UJ 




cn en 








U4 UJ 




<r 




3 3 








l-i i-i 




cn 




en cn 




en 




o O A 


A 


<r 




JJE 


Z _l 




i i O 


c 


CJ 




X X A 


A 






UJ UI 




CO 


cn 


UJ 


UJ 


Lu 


UJ 


cn cn 3 


1> 


2> 


A 


lilSH 


n 


M 


o 


lu uj cn 


cn 


LO 


u 


1- H o 


o 


C7 




cn cn _i 


_' 


| 


> 


O O i 


u_ 


i 


1- 


o o X 


X 


X 


n 


A A U 


Ld 


Ui 


UJ 

O 


GPlfl 


-0 


a 


z 


-i r-4 —I 


r-j 


c 


z 


X s. s. 


S 


s. 


o 


cj r-j co 


CO 


a~ 


u 


W ~H O 


o 


O 




s. \ s. 


s 


s. 


A 


fO -C llT 


IS 


< 


z 


rs n rs 


rs 


rs 


<E 


_i <r <t 


u 


c 


en 


M 3 u 


z z 


CO 








<i 








-i 




z 




u 




o 






A 


h- 




> 


OC 


A 




A 


O H 


CC 






i ii 


a 


z 


i-i 


-4. Z <I 


Ll 


o 


UJ 


Z i-i u 


Li 


_l 


V- 


<C i UJ 


Lu 


—I 


Li 


i _i t- 


X 


<: 


o 


U. _l z 


1- 


u. 


cn 


UI <X 


3 






3 3 Z 


CC o 


UI 








X 


as <i <z 


<x 


<: 


<z 


rj «• r* 


jT 


Ds 




oo-o 


T-f 


C 


CO 


r j m o 


is 


u - 


A 


o o o 


© 


O 


i 


<r -h co 


0> 


111 


O 


o o o 


o 


o 


U 


»r rs w is 


UJ 








CC 



-171- 



e 
n 

ui 

c 
c 
4l 



ttttt^^ • i~~~~ZZiZiZZZZZ.L"^~ZZ ' "ZZZ — ZiZj.»Zii~»4.i — 4»» 



o: w — mmmwNNW«»m<» — Nmww«wmmwww«mmwiftww»wmmmwmwmmininiftiftwinin 



tn 

u 

fie 
5 



M©©©K©©©tt©©K©©©K©©©o©e©©©©r<©©©©©©©©©©©©©©©©©©©©©©© 

N •« N •• •» ft 

rgKKKMKftftftKftftKNKKftftKKKNKftrNIKftVftOKKftftftftrgriKKKKKKftKK—Kft 

«*•■«• «. tsi rii •• ft •« ft ■« rjfj»«««<fM"«riiN-< « ft ••»Nf<fJMNM««<»<«<«»>h««« «■ ft 





a 


tn tn tn tn 


09 JO) 0) JO) JJJ JJTJJJJ J 0) 




tn 


a a a a 


a ca a ca ccc cccccc e n 




j 


j -J JJ 


j oj j ©j ©o© oeoeo© e o 






© o©o ©© ooo 


©©©©« > ©©<MO©©oino©©©©©o©©©©omm«oo>'©©©©oow©©©©© 


e 




in © © in 


ft k ft tsiM'O©©*- * on in © 


K 


^ 


*o on 


N — « _ < © N ft ■« ft 


©> 


r 


-•©ps 


n n v 


«■ 


c 


■* 


• v 


Z 

u 


££ 


to tn 


e z a a to tn es j z as a 
jjaaooz <c zzztn j jjz zjj zz oz 


a 


Z 


j jen 


r 


M 


<b ♦- & ft j 

i£U) X U kw 

ce zjz z 


*=^u.u©e& a aaej t c fc ^ t» ©*- *- *- ^ *» a a *- s a *• 


u 


€ 


ZZ 33k«b U.kvUON< «© Z UI UIU) UI U.U. UI 3 u. ui 


u 


1- 


zz © ©©z©*-jz z j jjjj j- _j 


u> 


g 


zcjcuzxo: 


z x© s x x x « x a x x x s ■» n zn z i- z ui uz*-zjjjjxxjxxaj 


a 


5 


«J«J-«i-<OCft 


<c{efiezosusr<iCos5uu«uepcsN«'SSK«©c<cccc6<ser>ic 


5 
z 


U 


jebanjaax 


ufifiafifietBxfififi^tcjsuBfNvinnriopfiUbb&ba&ba&xi 


o> 


o o© e m© e ©o 


©©©©e©ee©©©©©©©©«e©©©©©e©©e©m«c©©©©in©©©©©©m 




u 


e o no in in© 


©©©co © © oms © «• © m © ft © © © © <o © «• © © © m ft 


P 


o 


«iO<©o>o>m©©omo mm© mm n m n m *■ •» m © m -> 




c 


•■ k » » * 


» » * * * » » » » » * » » » •• 


n 


z 


© <C IV K«« 


>c © m «■ © »« « © n «• •« «■ <e o n 


K 
0- 


a 

0) 

k> 

i 

Z 

MM 

s 

? 
c 
u 

a 


w* 


n n n n 


o 
z 

M 

CD 

Z 
UI 


©©©©©©©©©©©©©e©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©©© 


© ©© © ©© eeooeoee©©oeeoeooe©©-«©oo©oooeo©oooooeooo©©oe 


tn 
t» 


<e<<<c<« 


aaaaaauuuuuuu 




•1 J J -J -J J -J J J 


jjjjjjjjjjjjj 


U 


« 


U. tv £» U. £. k, £. k. k. 


Lu.i.CLi.&.&.&ii.(L<L£i.u.e:zzzzzzzzzccze£zezzzzzKZzzzzzz 

xxxxxxxxxxxxxsbobsbbbbbbsobsbssbcsbbsbbbs 


U 


-i 


K XX X XX X XX 


< 


u 


UbJUUUUUUU 


UUUUUUUH'UUIUUIiiUwUUk-UUUUUUUUUUUUUUUUUUUUUUU 


z 






BI0S09 0> fc) OS JJ OS OS 0) • m 


c 




c 


a ui ui c c naiobon * 


4 








tn uj ui 


as os tn o> j z s ja uuu zz oj utuiuiLJuiuiuuiuiuiuui 

taaoimust u.«os©«<©obcoo aaa •ausssSzssSsSsz 


w 




w j -j os tn tn » tn 


w 


>• 


j z>- k s>s> © ©5 


cc«< s xcfzzzjj~ © e — ■m - r a 


z 


*» 


JJJjR3ZD)Ul-:iICCeZZZZZ-«3 3S eStUIUIUIUIUIUIUIUIUiUIUiul 

uuuu£cj,oz zccc a jjbbbsbxbbsbbbbbcbbs 


ui 


M 


UmUCJmmmmm 


3> 


a 


c ui ui tn tn tn tn us 


©cruize aa>-aaaaa mmmmsccc<<c<cc<:ccc 




s 


tn i -i ©o o oc 


zzzzouaw zi:uuz33333en as S 55 © © s o so s s 


o 


z 


uuoo jj j jj 


z 


z 


»»KeIlLLtL 


<<<CZ ZUJCiCZC<<3BS8B33klUlilBt>n»Ki»t.hh!»f^^^ 
JJJJ JSOSJCCC MMMMM<<ZZZOarBBBBBBBBBBBB 
JJJ J »•»<<•" U!l 1 iUUUJJJJJUUmwwUZ 


M 


B 


NM&iKXXXX 


©• 


u 


tn tn uuuwu 


J 




© © © © 


uuuuu>u msjjjMMM jjj MZtnonooosososostnuses 


o 




j j j j zz z :: 
b. tub. E OB ©ota 




i 




836 3U*BfflNJ<<CUIlllil««««"»Xi£^j:«K3r^>«hk>i*i».|.i.h|.i. 




X XX X *«•" ••• ■«»• 


c£zzzbj.bbb»szzuuul;uuuujjjjjjjz<<<:«<c<'C<c<« 


»■ 




UI UIU UI zz z zz 


£kb.u.i»ztnuu.u.SKtist.-s«c«<<<«<c<c<«<<«aaaaaaaaaaBa 



u 

z 



ui 



«0"N©©rvimm© 

eriNM««NNM 

VWV«vN.N.VS 

©©N.o«m<<< 

« — ©«-.©o©e 

N.V'vVVS.'V.W. 

Bn^niflin*** 

N KN N NN N N K 



<rn«onnm©D»nN©v<©m©m'C<t*-N© © o» o»0'*^fMNnN«cr5^o-s©»i"s«p 

©•«— N«N-«noi'io©«>onN--N«« «*m nne«NNneNn«8en« ©© 

S.S.VXS.S.VVN^N.N.VS.XVWVN.VS.VS.V.WVSVVVV.'VVV.'SVVN.'V. 

fJN«NfJ«<f l |f)NBNM')D««Bei"<*«eN"<O<0««**NieN©«NKI<)«<rNf!N 
OO«<0O©«0x©©0O0©»«>©©©©«a«<©©0©0©©©«>©©0©©©©©© 
NWN.'SS.V.'vS.S.N.VNVN.N.VV.'SV.N.S.VVN.'WXN.N.N.NwVS.'N.N.VVVV'S 

B<n*«ll5«N<l(lfirKII)<OBBN8N»tfiNNNBNBI , )t*»*«<»»r|f!< 



r*T-^i^r^»^r^i^j'*i^r%ivr%rvrvrNrxi'*i-*c^i-*T^r*rNrsrsrsr%F , %r*rvrsrvrsrsrsrsrsTNr^rsrsrsrsrsrsrsrsrsrsrs 

3 BUZZZOKNrjNCJKXJN€N>. - ; 0e , > .r3xjXCJ}-Z€€€XZ«<J€UljaO«€avC 

S IZ^OOie<Z«C3k€^"e3NZ»:«ii{Zt.«<^S«3P8 88f«Ut»BZ«£UUiSJt 





< 


z 




u 


ilk 




© 


Ok, 




J 


a »-b 

JUI OS J 




t- 


ui j za 




z 


« j u a 




UI 


2k- ZZ J 




a 


-B3U8C u 




«• 


j -x a u_/ - 




u 


4. ■■ © >- » i. © ©<*. 




z 


BSZCUS") ".X 


© 
© 




-S BZ 0) S4 € CUI 


s 


< «< « << a c< 


1 


z 


k m*K «n«-» 

lfl^N©S«KK< 


m 


«B 


©N««*vK©©«e 


Wl 


z 


©©oo©eoo© 


1 


s 


o««©o«"mvvK 


z 


c 


— «.©-.-.&© o© 


« 


u 


sn*nnwNN< 


"3 


z 






.©©©©©©©o©©«--.&o©© — — o©o© 
im^KKmnn<cin<«emNOK«vmNNNB 

• • • 



-172- 



V. 



J 
l» 

ce 



u, 
z 
< 



u 

UI 

z 



tILiLLl.LIIIIIIIZIIIIIIIIIi:iIIZIIIIIIIIIIIIIIIIIl.LI 
I I I I I I I I I I I I I I I I I I I I I I I I I I I I I i I I I I I I I I I I 1 I I I I I I I I I 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

in ■* in in in w m in in m in in in in w m in m in m in in in in m in m m in in in in m in in in in m in in in iii n m in ji iii n iii m 



OOOOOOOOOfMOOONOOOWOOOOOOOOOOfiNOWOOOriMOOOClOOOOOOOCMO 
CM »< CM CM »< CM C-4 CM CM 



u. 



NONNNNOOMNMNNNNriN^nNNNSNNfmNNnSNNNNnrin CM CM CM CM CM CM CM »« CM CM f-1 CM 
CM « h M h CM NNH -4 f-4 CM m M m m m h m C4 h CI •* »< •< M CM CM f-4 CM CM CM CM fi CM 



Ul 

a 
x 
ui 
u 

Ul 

a 

3 

at 



UJ 

a: 



a a 



t i i i 

<t <x <x <x 
ooua 



O) 01 _l _l 

aa (- <T <L 

_i a. a a 






_i_i_i_i_i_i_i_i_ioi_i_i_i_i_jco 
<t<t<r<r<E<r<x<r<r«<r<r<i<i<ir- 

0[3O00OO130JG01313l3C 



n><ooinovoo«ino90oononooooQoosoNOOoooiooNtiog-<<fOrtOor-ioM9 
cm "O n \n o own in cm o> h« mm NNnno to«t 

CM © •* »* »* «0 CM P) CM 

a 
cttctca 

A A A O 

j£ U. U. U. 3 
Z 

« X X XX 

-i o o a a 

A A A A A 

©©ot>oooo©oo©t*iooo©oo«rooa:omoo©oooo©o©oom©inin©in©©oo©in© 
* in oowoon ovmooNooooo oo o o o o n n n n o m ri m o o o on 

tv o ui<h oo cm Nino o m »< © o cm ommo * n <* in cm o fi «r 




*• o 
in 



0©00©0©0000»hOMOOw 

o 



n •* in 

CM 



oooooooooooooooooooooooooooo 



o o o o o 



oooooooooooooooooooooooooooooooooooooooooooooooooo 



atatatacatatatatatata: 
oooooaoooao 
uuuuuuuuuuu 






a 
o 

x 

X 

o 
u 



at 
o 
a. 
ui 
at 



t- I- t-t- t-t- 
UI Ul Ul Ui ui ui 
3 3 3 3 33 

lil ui ui Ul ui ui 

O CD CO CD (9 O 

<i <c <i <r <c <x 

at at a: at at at 

o o o o o o 

hl-hl-l-h 

tn w in to co co 

co en co en en co 



ooooooooooaaooGOOoooocoaooocaaoaoocoooa 

UUUUUUUUUUUUUUUUUUCJCJOUUCJCJUUUUUtJUCJCJUCJUUU 

uQuuuQuaGuu UUUUUUUUUCJUUUUUUUUCJU 

O HHHHHHHHHHH 



a a 



A A A A A A 



Ul CO _l _l 

CD O 

« i- a. a. 

at 3 x x 

o « o o 

h\UU 

CO 3 

at at 

co co ui ui 

t— i — i i 

|- t- >-! H 

<t <x o o 

A A A A 



a 

11 x 

_! CO 

<T 

a. t- 

x o 

o a. 
u 

Ul (J 

at z w 

UJM K 

_i X 01 

i-i a 3 

o at <t 

iii a u 



3 

at a: at a: « 

OB Q A -I 

<t <r <r <t <r 

uGuuu 

o o a o 

01 CD CO 01 CO 

uuuuu 



t- I- I- I- t- 

01 01 01 CO CO 

<r <t <t « <x 

uuuuu 



3333333:33 OBOOBOOOOOOOCOCBOOOBJ 
BBBBBBBBBBBmhmhmmmhhmhhhmmhhmhmU 

►Hi_|,-||_ll_|_,_,!-4!-!WI-!_l_|_J_]_|_|_|_|_J_|_|_|_|_|_J_|_J_|_|_|X 
-I -I -I -I -J _l -J _l -I _l -I X 

C0OOCDOC3CDCDCDC3C3CDCDC3CDC3CDCDC3CD3 
««<r<r.'I<r<E<E<I«tljJZZZZZZZZZZZZZZZZZZZZ 

WUUWwUlLwuul>HHHHHMH'-tMHHHHMHMHHHp-3 

ooooooooooiizzzzzzzzzzzzzzzzzzzzii 
cocooicocooioicocooi <i<i<i<r<i<r<i<i<t<rc<i<r<r<E<r<i<r<t<i_j 

OtLUUiUitxIUiUJLUUlUlUlUlUlUllLlUllllUlUiUiLi 

uucjuucjuucjcj<i_i_j_i_i_j_i_i_j_i_i i i r i i i > ; t i 

ii(iiin.i(iiiiiiiti|-UOUUCJUCJUC_>CJUUUUUCJCJUCJUO 



►— t— ►— I — 1— »— »— I— I— »— 

01010101010101010101-10.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 
3333333333«XXXXXXXXXXXXXXXZXXXXX 

<x<i<c«i<i<£<i<z<c<ioooaoooaoaooaoooocoaaa 

UUUUUUUCJUCJCJUOUUCJCJOUCJUUUCJUCJUUCJUUU 

o•1»■lnlnlnl , ln-l^»■^ly^•<•Ort^o•o<^l^n■ovooon^^•^^Hr)H<r-l^<rb^n^^^^^a)MM , l^ 
h m w o o n h ^ h o •< « in n h « o n o n ^ h m a m w h « n o n n o m >< n o fi ri •< fi « o •< o i - o ri C4 

^m^^coenw>o^Mrvivc^wN^^M'^MC^Mi^vfirtivMCMfsc>'iNrt^-r<»n^<ro«rfisir^co--iPsO'Ofi>o 

0©0000©0»iO©00-<0000©0»<0©©-i©00'H©000©00©©ihO** ©00-<©-*0»h© 

MB»rn<rincoi , iNQiNNbi*in>0'«'0-o<fr)wn*<5iii-o>on<r<» , <riiiiBN<iiiiMDNMBoiDcoaNNN 
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 

Hiii«<i;2<iNZz«z<iMioxhxui->o2a«vx<N2>0£>-i«<i<ijj^«zozi>j>« 

XZ0.0.Oi-i0.<l>-ii-ia.l-«rOXt-UI-X33Ui-H«o^l-3>-Il-Z<IZOi-.u.U<I-OO>-HXXZ^i-^:O 



3 
_l >UI 
Z> t-w 

at z « => z 

a ui o u o 
o <t t- co ui 




ui u 

<x at a 

t- <t CO t- 

<i z 3 <r <r 

01 <t <t CO )£. 

-I _l -I Z Z 

3 I- Ul <X <X 

i- <t a \c x 



Z Ul Ul 
Ul -I -J 

^ _J I 

3hJm« 

1 3 J 3 I- 

01 Ul ii 01 Z 

Z m ^ « «t 

Z 3 Z 3 -1 

ui o <l a i- 

0. _l ii -I <t 



MCOMfs<iMcorsO«^NPN»o^f4*THri»-iii"i»^fj| , ^fl - rgoDoro»-ir-iri^'rNui»-iiiTiirNCDi>'Hi^o>a»Hi>> 

OOOO^OOOrtOOOOOOOOOOOOOOOOO^OOOOOOO-<00000-<0»HOOO 

^lncon^(D^Ml1lnln<a■o■0'44'4'«lonln'Oln'OMo<rwlfla)^<<laMDa)^co(Dcocoa)^o^ 



-173- 



o 

111 
o 

4 

a. 


UJ 

a 
a 

£ 


xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxo.cvCva.a.a.CLCvXxxxxxa.xxxx 

iiiiiiiiiiii ■ ■■ iiiiii ill ill tiiiiii ■■ iii ill til ■ i i i i 




• 111 f 1 llllll lllllllllllllll llllllllllll ill III 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 


x 


X X 


X X 




cc 


in in in cm m in m in m id m in in m m in in id id in in in in in in in m m w in in in in in in m in m m m m -o 


m mm 


UT 


m m 


m m 






to 

UJ 

cc 

3 


©©©©0000©CMO(NOOOO©CMOOOOOOCMOOOO©OrsOOOOOOO©©0©000000© 
M (M CM CN »4 






M 
« 

u. 


~* »h CM CM 
«iCM CM 


is rs 

•" 1-1 


CM ts Ps CM CM -< 

H>4 CM *4 


CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM -4 rs CM 
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM C-4 CM CM CM CM CM »4 »4 CM 


CM CM CM 
CM CM CM 


CM 

CM 


c i rs 

CM t4 


CM ft 
CM CM 






a 

(0 

-i 

UJ 

cc 

X 


_l -1 -1 

(9 O O 






jjm 
<r cn 
ooo 


I 1 J I — 1 — 1 J 1 1 — I 1 1 I 1 I I t CJ-S J I 1 1 1 1 I 1 (0 

«««<i<t<t<i<i<i<t«<r«<r<i««H« <r -x <r <r <r <z <c a 

OOOOOOOOOOOOOOOOOOO OOOOOOO — 1 


_l CO CO 

<z a as 
e _i_j 


-I 
C 

a 


_1 

O 


_l -1 

o o 




O 
rs 

o 

t4 


* o o o 
-1 © 

»4 


OO 


ooo 


moo 

*-4 


(MommooooO'HOoooootnincMCMOO'OooinoooocN 
moincMCMO-oo-i «on t*> o«ooo oo >o 
m cm cm m is m ^v riomm<r mm m 
n •< v «r cm n 


ooo 

moo 
>o <r 
ro 


o 
m 
rs 

CM 


»4 © 


rs eo 
m m 




cc 

UJ 

a 

r 

UJ 

u 

UJ 

a 

3 

cc 

X 

n 

JS 

o 

ll 

>• 
-1 

-) 

O 
Z 
n 
li 

3 

a 

(0 


CC 

z 

<£ 

z 
o 
(J 


(0 _l 

_l 1- 

G. X 

-1 X 

« 3 -1 -1 

<t CC CO (0 3 (0 

u. a cm cm cm cm 


-J 
cc 

1- 

«r 
•^ o 

Z M 

<I 03 
K- X CM 


o 

(0 
V _l 

O CL 
B 

cc a 

<X 1-3 

o rn 


en a j mm * z jccb w co 
-i cecoi- en _i _i cc cc y- a o _i cc _i 

0. hJZ _l u. O. 1- 1-XU.OCvCi.Ci. 

*tm <iscvrs>oo o cm n rs 30. 

OOI- OZi£ XOO _l> MJii^OOiSrr _1 cc 

nnzuunczssnniiiaui xkzui nzr«)MMZ33enoz 
oooNrso_i<t3ccoors3isTisoorsrso<tooo<tci:ceui<E<ri 
xxo»4»4rai--)axx T 4T^inM«0'»4mxKxxxi-aoi:u.a_i 


_l 

1- 
X 

X 

1=1 


CO 

a. 

a 

3 <E 


co co 

-i -t 

Cl u. 

CC cc 
z z 

n n 
_l _l 




(0 
UJ 

e 

<t 

X 

a 

(0 
UJ 

n 
CC 
3 
-) 
Z 

tl 

(0 

X 
►- 
<t 
UJ 

a 


onoo 

«r o o 

in o 

CM 

o oo o 


o o 
in in 

o o 


o o© 
m o 
00 o 

rs 
ooo 


ooo 

M 

O ©O 


>oooonooooooooooooomooooooooooo 
inooisomoo o mcMO o ooout 
c*ooino-<om o m o o m o m 

i-oin »4 o cm m w m m ** 
»r cm 

oooooooooooooooooooooooooooooo 


o © © 
o 

© 

O 

n 

wo© 


rs 

CO 

^4 

n 


o o 
© o 


o © 

o © 




o o o o 


o o 


o © o 


OOO 


oooooooooooooooooooooooooooooo 


© o o 


o 


o © 


o © 




z 

UJ 

a 

M 
U 

u 

<t 

CC 

« 
-J 
3 
CJ 
i-t 
X 
UJ 

:> 

o 

z 

M 

;> 
-J 
o 
-> 
z 

M 


(0 
(0 

<I 
-1 
o 


te.ie.ccte. 

o o o o 
ooo u 


ccce. 

o a 
oo 


cc cc cc 
ooo 
ooo 


cccccc 
ooo 
ooo 


CCCCCCCCCCCCCCCCCCiCCCCCCCCCCCCCCCiCCCCCCCiCCCCCCCCCCCCCCCCCCCCCCC 
OOOOOGOOOOOOOOOOOOOQOOOOOOOOGOOOO 

ooooooooooooooooooooooooooooooooo 


cc 


cc cc 
o o 

CJ CJ 

cc 

o 
o 

-1 -1 
<z u. 

o 
11 1- 

X i- 

ui <r 
x a 
o 

cc 
m t- 
o o 

3 Ul 

CC -1 

a ui 


cc cc 

o o 

O CJ 




K 
*-* 

a 

o 

X 
X 

o 
u 


COMP CL LIQ U/HFL 
COMP RUST REMOVER 
COMP RUST REMOVER 
COMP RUST REMOVER 








en co co co coco 


CO 


_l -J 

u. u. 

K 1- 

<t <E 

a a 
cc cc 

1- h- 

o o 

Ui Ul 

_i _i 
Ui ui 




(0(0 


(0 (0 (0 


CO coco 


(O(0(0(ococo(ococo(oa)(n(ocaco(0(0(oco(0(0(0(oco(oco(oooo 


ooo 


o 




a o 


ooo 


ooo 


ooooooooooooooooooooooooooozzz 


z zz 

B QO 

t 1 I 

OOO 
CO CO CO 

cc cc cc 
cc cc cc 
ooo 

U CJ o 


z 
a 

_j 

o 

CO 

cc 

cc 
o 

CJ 




zzzzzzzz 

oo ooo o oo 


zzzzzzzzzzzzzzzzzzzzzzzzzzzaae 

ccccsoscaoccccocosccGcccsGCjjj 


CO 

Ui 

a 

o 
o 

> 
1- 

11 

a 
o 

X 
X 

o 
o 

a 

z 
<t 


oca: 

CC CC 

o a 
o o 


1 I i I I 1 

cccccc cccccc 
cccccc cccccc 
o o o o a a 
o o o o oo 


1 1 1 1 I 1 i 1 1 1 I J 1 l_J 1 1 J 1 1 1 1 I I t I ICOCT3CT5 

CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCiCCCCCCCCCCCCCCCCCCCCCiCCCCCCC 
iCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 

oooooooooooooooooooooooooooooo 
oooooooooouooooooouoouoooooooo 


(0 

1- 
z 

UJ 

a 

u 

z 

M 


UJ 

a 


MONO 
CM CM O M 

^0 09 CO O 

O OO -4 
V N S V 
NM<0O 
PS IS rs |S 


«4 m 

-4 CM 
s. \ 

OK CS 

o o 

s. s. 

mm 
isrs 


NVPI 
CM rtN 
\ N N 
O N CO 
ii O O 
V X X 

m <r *• 
ps is rs 


<0 M-« 
CM O CM 

s. \s. 

»4 MCI 
© O -i 
% s. v 

■OCO'O 

rs rs rs 


Gsrsam*rrMroin«4mm(sinoorsiscsin-HmoOKin^ - rsm»4rsoK 

lHCMCMO«lOCM©»4»H©T40i1ilO©CMCM(MO'"40'<1'1'1'1»4CM-4 

NS.NVS.S.s.s.N'SVS^v.v.vs.NS.VVS.vvxs.S.xxvv 

ina^innnrtNoi , iNiiiininin>o-oiM5i , )NcooMii»o>M^ 

0©0000»4©iiOOOOOOOOO-40©0^0'4'-4©00© 
NS.s.s.s.vv'ss.s.s.vxs.VVXs.vV'sNS.vXS.'SS.N's 

coomoisis«orsisisaisfflisrsofflcom«r>oooa(sinrsmm<-m 
rsNrsfsrsrsrsisrsrsrsrsrsrsrsrsrsrsisrsisrsrsrsNisrsisrsis 


OS OK CN 
CM CM CM 
V V N 

*0 >0 >0 

© o o 

•s \ \ 

is rs rs 
is rs rs 


M 

-1 

s, 
CO 

o 
s 

IS 


r*> -o 

CM O 
S. V 

•-4 <r 
© © 
s, v 

rs rs 


m co 

CM CM 
N S. 

a et 
© © 
s. s. 

rs rs 
rs rs 


z 
o 

M 

►- 
<t 

u 

o 

z 

UJ 

a 

H 

u 

z 

H 


<4Z<««-|Z<XJ<UHHO«JI{>«Z1tZZ««XU«<H-JO<XX«ZJ«<[« 

3t>HUHHZhLI-lLLZIIZH«OUZ}»-ZOHHHHt-|l)JLUHUJhl-UI-HOaO 


<r 

3 


> o <I <t 
ZZ 1> 1> 


m 

CO 

<r 

-J 
o 

> 
a 

a 

Ul 

t- 
cc 

a 

CO 
UJ 

cc 

<z 

CO 

a 
cc 
o 
o 

UJ 

cc 


o 
oo 

0* 

1 
in 

»4 
1 

z 
<r 
-) 


_l 
-J 

UJ 1-4 UJ 

_l X* 

K OO! 
KfivZ UJ 
<X X «Z iC 

ui «o « 

CO O CC A 


<t 
■e. co 

3 <X 
i£ CO 

o <X 

ui z 


a. 
i- «t 

Ul O 

CC Ul 
Ul CO z 
h-JO 
CC -1 CC 
<t 3 > 
O At- 


X 

oo 

«CC 

UJ3 

ui a a 

ii CO 

2 Old 
ZCC-I 
n Ul i 

3 =>X 


« 

M 

x <r o 

Ul CL > Ui o o cc 
Z Z H--IZZZZ -J CC OX JO 

a zi-> k <zccui_ioo>->- >ui3 « <r cocas 

kzozji-z >z«KH(noij jozuaa cc a. 3<icot- 

3OC0O^H-O(0UJ<Zl>Ull>CCCCJi£^Z<£_l<:CCZ3>iOUICLUJii 

iui^royErjiHKiuuooHU3JLiojOHu: zx 

30UyaZUJiLUJ(i!KBaoOKZ0HI-XJZZBZ>-E 
U>i<ZCCC£<XCCUI>i30<X0ZZC£CCCL3CCX<Xiiui<ZCZ<X<I3 

zcL~)u.A_iu.xccAaoQ<c<iffiAcoaoci.3ai-i-co<ico3co 


<t <i<t 

I- »- K 

z z z 

<£<!•« 
_l _l _l 
1- 1- 1- 
<t <t<t 


O 
CJ 

en 
<x 
u- 


o 

-1 3 
<Z <Z 

u. a 

Lu CC 
3 3 
Si Si 


-i -i 

_i _i 

Ul Ul 
3 3 

a a 
<t <t 

X X 
CO CO 


o 
z 

»- 
cc 

o 

0. 
UJ 

cc 


« <i<r <c 

03 «0 CM f» 

«T 00 N »■ 

o- »< w m 
© o o o 
rs o a ■* 
OfiOn 
rv w >o co 


<r <x 

M <0 
M OK 
«0 M 
O O 
> O 

O *4 

mm 


5101096A 
4070726A 
4090347A 

6020586A 
8040918B 
7010306A 


«<r<i<t<i<t<:<c<r<t<i<<roi<rfli<i<r-i<r<i<r<i<i<i<i<r<iaJCi<iLij_j 
^■or>.ii»4>ori-omo>m<imuTmroronmN<OiinrjrM»>0'<r«r'rrsfsrs 
<-o-offlHoo-aiio<roin'Ooooooofflr'00>o(oiniHnrtri4Mr)M 
^v>0NrirscM>cmo©or*>* , *'CMCMt'Jr4,i>0ii»4fl-'H©t*>CDr-iinrsrsrs 

©0©©0©0©00»H©rtT4»4»4»400©0^4»400»1©©0©0©0 

>onuimMMCJNO«rcM«ommm<i'Oori'risoooco©-40KCN©<rrsisrs 

©©©©©©^©^©©©©©©©©^^©©©^Ort^OOwOOOO 

ooc3aaoorsrs<rsisrscorscorsisoomaocDq'<o(Dcorsrsrsffiin«rcorsrsrs 

• • • • • 


<t 

CD 

-i 
CD 
O 
-0 


<r <t 

© > 

ro ro 
© © 
cm «r 
o © 

>0 * 


a o 
m m 
ut m 
n w 
o o 

M M 
O O 

rs n 

• • 



-174- 



Ui 

a 
o 



xxxxxxxxo.o.o.o.xxo.xxxxxxxxxxxxxo.o.o.o.o.a.o.o.o.o.o,o.o.o.o.o.o.o.fi.o.o.x 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxzxxzzzzzz 

in m in m m m — m in in in m m in in m in co in in in in m in m m in m w in m m m m in in in in m in m in in in in in in in in ui 



©OOOOOOOOOOOOOOOOTOOOOOOOPIOOrtOOOOOOOOOOOCIOOOOOOOOO 

»h CM CM PI 

CM CM O © O CM O PI IS N N PI (M CI PI N N 00 P- rs tv N P I PI PI PJ PI (M t*> t* PI PI PI PI PI PI PI PI PI PI PI PI PI PI PI PI Ci PI m PI 
PI PI PI CM ■* ~4 *i C 4 PI PI PI «* »n h h h h CK< M CM PJ »* PI PI CM CM CM PI CM PI PI PI PI PI PI PI ** PI 



in 
n 

r 

Ui 

u 

w 
a 



3 
-i 

to 

2 

us 

a 

to 

f- 
2 

UI 

a 

M 
O 

o 
<t 

cc 
<t 

_i 

O 



a 



_i_itoeoco_itoto 

««t-f-H-«KA 

OOCLu.u.Ou._l 



-I -I -I -I 

<I <I <T <I 

OOQO 



tn r ; i i i i 

a <t <r <t <r <t <l 

JQOQQQQ 



a a 



— f l — I i — I — I I : ! ; i i s -1 

<t<r<t<t<t<i<t<t<i<r<r<t<x <t 

0Q13O003 0GQGO (3 



wr^rowcMrvpioooowinocoooooooooo^orooPioooooooooorooooooooooin 
* m no ri -< o n <r o o o o oo ino—owoouioooom 

o on xinno o * \n ^~«rtinN©©r^oo©m 

o pj»< co cm w pi m » *■ pi ro v ri 

pi 

en en en en to en to to _i * a _i * _i _i _i _i *s jjjjj _i _i en 

-i -i -i i f i i — i cccc cc toceoccece cc cc cc cc cc cc cc os cc _i 

CLO. O.O.O.0.O.O.H-t->-H Jhhhl- K t-H-H-KK-t- 1-1-0. 

O rt rt rl H N rt M M fl fJ N a. •< .tS PI PI 

us as cc cccc cc cccc sc^Aic-it^-^^-tw^^^ -*.jc ■*.-£. * •*« ic z ■*. -*z -xi ■*.■£.■***■*.■*. s. 

"Z.-Z. 2 Z222Z 22uS2Mr*>mfOMWt')r*>r*>r«)r')t3ZZZZ 2n_l2<t22222nr0223 

i-i i-i i-< wi-ii-ii-it-ia<i<t<r<i(juuucjuuuuuu3<t<t<x<t*'<r<iuen«_i<i<r<rc<iuij<i<ij: 

_i _i _i jjjjjfii-hui-ritirirrrini-hhi-niii-tfii-ai-i-hi-i-iii-i-i 

oo*-<owoooo-4ocooooooo©©ooooo©in©iv©o©omin©o©ooooooo©o©©© 

^MionoinainHinoooooooooooooHONOooor^ooe o uio moo 

pi o ui n o pi in »h w o o o o rs o ^ pj pj o in hnoohpi^oiii pj *h o to o* in 



in in o in n ch 
n -< cm 



o o CM 
o »« 



CM rt 
PI 



M ooooooooooooooooor^oooooooooooooooooooooooooooooooo 
ce 

3 

~i 
z 

HI 

to 

z oooooooooooooooooooooooooooooooooooooooooooooooooo 

»- 
« 

UI 

a 



CCCCCCCCCCCCCCCCCCCCCCCCCCCCXCCCCOCXCCI^CCCCCCCCOCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCOCCCCCCCCCCCCCCCCC 

00000000000000000000000000000000000000000000000000 

CJUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUCJUUUUUUUUUUU 



_l -I . 
u. u. i 



o 

CO 

o- 

*-* 

I 

u-) 
•1 

I 

2 

<c 



I- I- 

A A 

cc ce 

I- H- 
CJ u 
UI UI 



A A i 



I- h- 
A A 



a 

JJJS 
U. U. U. m LU 
(J z 

I- I- K <Z UI 





aaoaaaaaaaaaaaaaaa 


a a a a a a 


a 


a a a a a a a 


A 


UCJUCJUUOUUUUUUCJUUUU 

«<i<t<t«<t«<t<s<r<t<t<r<r<r<t<E'« 


u u u u u u 

<L <L <L <L <Z <L 


u 
1 


u u u u u (J u 
<t <r <r <t <t <t <t 


u 

-I 


uuuuuuuuuuuuuuuuuu 


u u u u u u 


u 


u u u u u u u 



u o 

UI UI 



0) 2 U 

U O "-" 

uooooooacoooaooooooooooaooooaoooa = >-s 

>i_J_l_l_J_i_|_l_l_l_j_i_i_i_|_l_|_l_i_l_l-l-i-i_l-IU-J-l-l-J-l-ll-33 

azxzxixxzzxxxxxzxzzzzzzzzxxxzxxxxx_i_i 

OUUUCJCJUtJUUUUUUUUUUIDUtJUUUUUUtJUUUUUi-iau. 

H-iooooaooooaaoooosocoooooooooooooostoo 
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-j_ja 

>->->>>->->->->-V)->->->>->>>)-V>>->>->>->>>>>>)-UU>- 

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 

cococDin'rtOOCoiso-csisuT-or'jrscoivrtiiT pi ooa*-oo-ors©tNr«)«ot>>o«oo-c ri niiitt-MioNoco pi Q-*«r 
N N o h o n o n n h m n n h « m o n o n n n « n o •< o h n o o t o f i n rf o n h ru-i o rui n o h c< m - 

Pi pi «-t m pi c-i -o is -h « »-< th .h rv ts to to ts pi ts n <-> pi t-i cm o o« r* pi c^i pi v ■* o o » ^o in pi n o> o» o o« »h ro iii -o o- o» 

OO^OOOOOOOOOOOOOOO-rtOOO^O^wOOOO^O^—^OOO^OOO-^OOOOOOO 

NrsrNcocDrso3co^uTijTOBNiv>oiniiTMPO*iiTvisrsrsrs<oca4bT>orvMLTinrss)>o-o<rso3fs(scD03rs-o«riv 
NisrNrsrvivrvrsrsrvrxivrsivNrvp^NNfsrvNrsNisrsNrsrsrsNrsrsrvrsNNiNisrsrxrsrvrsrvrsNrvivrs 

<<<<4<JI«<[X-)NJiCJIZ?«?JI<ZJIIlliJZOX>XliJU^(IKXJX!(X)CXXZZ<< 
35MHH3U.O(L5l-Z<«Olt0MZU3MO0l-»^ZI-UI-3l-ZZ0^JhLI-Ohl-l-l-ZMjO 



<t <I <t u > 
A A A m X 

CC K 

otacaeocceceatccixcicaui 
i- i- h a r 
u u cj o <r 
ui ui ui 3 x 

_l _J _l _l UI 

ui ui ui u. x 



U CJ 
UI UI 

I -I 

UIUIUIUJUIUJUIUI 



>• w 

I- > U K 

•1 h- CC 

J JUH JJ OZ 
-I-I UJJO0.O 

uiuiH- uiuiauiH- 

33tOX33ZUlil 

aaui3^:a<ca_iLe 

«<ClXOO<IJHNO 

eotou.toociooAXi-1 



t- o. o o Ui 

u >-> to -i a _i 

Z 1X« -ItOZK-l 

<t UJ X CC O tO _l tS ZU31-IZ « 
JOHDZfifiJU>OUB)-Jlil4> 

jiczi-Hzziii>ui-Hcnuu^£« 
<uiui<til.<ciii3 Jiii-D3Mnyiii^ 
^*ouJjMiniozyzjouiuii-o 
<X IU4fi:£04<CH003JuC0Ch 
N2Ci.aX0U.A_l03XU<IUU»-3<C 



> X 

I- <L 

H- X 

<I <t 

-J oc 

0. O 



X 

o 

X 3 
H- O 

a cc cc 

ZOO 

<r 3 a 
_i a cc 
cc 2 <r 

O O CJ 

3 _l tO 



x 
a cc 

3 UI 

O X 

cc in i 
a i-i i- 

au.H 

iiUI 
<Z 2 U 

(J M •-> 

tO j£ 3 



cn cj 

Z3 

UI UI I- 

a lc 2 

z a <t 

►H 2 _J 

r <t a. 



X 

to 

« z 

a u. i— us 

cc a '^ cc 

3 2 U. 3 

•-• 3 O 

1 ^s _i X 



a _i :- 
zzwec 
<r o x us 

_l H- UI 
I- 2 O A 

to <r lj 3 

«l-Ouj 

ui to _l z 



ui <r 

i- cc 

tn <r 

m x 

c w 

A X 



au>>-v<t>-<i<c:<i<r<r 
ui Li co o* o in iiT ^o r*> to in n 
111 ui o o ^ ui co o co m CO PI 
nn«HHiirtM , )«oo 
oooooo^ooooo 
r«) ro « in in to <o co ■* n r j pi 
oooooooooooo 

NPwCOtOCONCOCO^-blll-lCO 

• • • 



<i<r<i<z<i<i<t<r<E<r<i:<t<i<r<i«««<t<i<t<tA<i<r<t<t<z<i«<t«<z<i<i<i<z<t 

N'OiiTMO-o<D»riMn<r-oi>.-o<riiiM-OHHO-ff'OrivMifr<ri < )'Ortffii'Oiiirt 
o^-o>or^-oiNUT>opiocKCsro-oiiT^'pi-oopiripoooco>oroo>«HPi>tsi^iiTrj'0 
i<)»r)nvHrtMNr<nrt-oco-OrtO<rTO»co(i)OTTO-ooco<rMio>o>TOO 

OrtOOOOOOOOOOOOO'HOOO^OOO^OOOOOO'^OOOOOOO 

n n n »■ co o n o n n rt in rt o »• rt n n m * h o o t -o -o rt (c f i » o o n n ui n o o 

O0«-*00*-*'"*^OOOO0*hOO0OwO^»h«hOO00O'-»O*H'-«OOO0'-*^ 

NrN.'OinbiMi«>Tin^ , coiscof > >.-oco-oin>orvMininh.>0'OTs^i>.cor«.fvcocor^-o»rrv 



to 

UI 



en 
to 



-175- 



UJ 

o 

« 

Cl 



to 
w 
ce 



a_xxxxxxxxxxxo.xxxxxxxxxxcvxxcvxxxxxxxxxxxxxxcva.xxxxxxx 
i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i 
xxxxzzxxxxxxxxxxxxxxxxxxxxzzzzzzxxxxxxxxxxxxxzzzzz 

m -o m m in in in to in in in in -o in -o in in in w in in m in in m in m w in w in in in in m m m m in in -o in ** in in m m m m in 

omooooooisoooooisrsoopjooooooooooooooooooopjoopjpjorsooooo 

m *4 m CM P4 CM PJ m 









li- 



en 

_i 

UJ 
ce 
CD 

IS h- 
0> Z 



CM CM IS CM CM CM M N CM CJ CM CM M MS ** IS CM CN CM CM PJ CM CM CM N CM PI CM PJ PJ CM CM CM CM CM CM CM CM CM CM CM CM CM CM IS CM CM IS IS 
CM r* CM CM CM CM •« CM « CM «M M m CM »< CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM «m M «M 



-I -I -I -J 

<t <t <I « 

oooo 



moo 
in 



*0 CD -O 



o oo 
in 



en —i —i 

a <t <t 
_j a a 

on n 

IS «H 



_t_i— j— ioi_icn_jcn_i_icn_i_icn_i_i_j_j_i_i_icn_i_j_t_i 

OOaOJOJOJOGJOOJQOOOOOOJOOOO 



111 « 

O K 

UJ z 

& o 
CJ 

3 

ce en 
z UJ 

<t 
w r 
rs « 

o- a 

cn 

v ui 
_i «-• 

X Ce 

-) 

o z 

Z w 



Z J 

ce cn o 

m CI A 



o * o 

Ana 



z i*j ro 

<E O O 

I- zz 



nnn 
ooo 
z zz 



0) 

_l 
a. 

IS Ji CM 
Z OZ — 

3 n <t m 

£UJU 

a z* z 



ooonoofioo»iiiiiioinoooofi'<w*incioo 
in in cm o ** «-< o o n m in is cm o o o m cm o ^ cm cm o is o 
is mo cm cm cm T-im n o h n Mil o o o >o — 

«M CM V CM t1 ^- On m ,* -i «r CM 

_l -I CO _l _l CflK^J CO * 

ce h- _i i-ce _i ce _i ce 

I- Z 0. Z I- 0. fr- 0. h- 

»N W CM ISM IS PI IS * * m m IS 

O O O © ie «m ZOMXZi£©M©rO'*:0_J»<M©:£ 

MMMMzn 3nnr3znMi>i:wzf)hWrtf)ziii 
oooo<ro«rceoocece<toooceo<i:ooooo<tx 
zxxzh-zroazzaai-xxzazi-xazxzi-M 



O M O O 

o m 



mOOOOOOOOOOOOOOWOOOOOOMOOOinOOPIOOO 

iso o oooooom — o moooco oois o -^ o © 

m o o o o o <r o cm -• o © oo oom 



nnMH 
o o o o 
z z z a 



-i 
ce 



m n w z 
o o o <t 
z z z H- 



ooooooooooooooooo 
oooo mm ooo oo oooo 

o m m o is is m o m o in n-ono 



O CM PI CO 0> l*> m 

** CM 



CD O 

cm rj 



o m 

CM CM 



m -« 



m pi NO 



CM 



ce cn 

3 Z 

a i- 

CO UJ 

t~ a 
z 
ui 

a co 

m co 

u <r 

u -I 

« u 

ce 

« 
-i 

3 
U 

w >■ 
X 1- 
UJ m 

:> a 

o 

o z 

z z 

ii o 

3> CJ 

-J 
o 

z 



OOOOOOOP-I^OOOOOOOOOOOOMOOOMOOOOOOOOOOOOOO— ooooooooo 

*■ CM 



ooooooooooooooooooooooocoooooooooooooooooooooooooo 



oooooooooooaooaocooooooooooooooaoocooooccoocaoocoa 

UUUUUUUCJUUUUUUUUUUUUUUUUUUCJUUUUUUUUUUUUUUUUUUUUUUU 



UJ 



tn 



z 

UJ 

a <t 
m a 
u 

z 

IH 

z 
o 



O w 
CO 

CN O 

<-t z 
I 

m t- 

■* ce 

I o 

Z Cu 

« UJ 

-» ce 



U UJ 

<t a_i 

MO 

CJ X CO 
•1 o 
-j ceuj 

HUh 

(DiLm 

o ce 

3 Z O 
-J UJ _l 

u. oz 
o oo 
ce ceo 
a a a. 
>• >-> 
zzz 

»>no 

S> % X 

•OISi 
O O rt 

ca r*> <r 
rs ms 

_j «> 



cn 

z u 

<r z 

z M 

a o 

i-i z 

u. cn z 

u. uj c 

iu az 



<r«aw<t-)<r.<r« 

MCDO-IS-OfsIvnCO 

^■o-o-nrswi-icoo 
is«r>oisorso>ofi 

»-<000«hO»hOO 

■oeor-iiscNrseoii')'-< 

00<iOOOOO<h 

CDt*>^'rs<ors^in«r 



-i -i _j 
ooo 
cn cn co 



ooo 

I — i ( 

X X z 
ooo 
ooo 

0.0.0. 

>- >- > 

zzz 

OK M OK 

CM CM CM 

•s s. V 

«0 CN -o 
ooo 

v v v 

rs «o is 

is ms 

o zo 



UJ 

z 

1-4 

z 
<r 

_i a a 
o *-* >-» 
zoo 
<r « <e 
z 
t- oo 

U HH 

o cece 

ZHh 

O MM 

ZZZ 

»« run 
o o CM 

S. V N 

Nino 
o o .-» 

V S s. 

>o m<r 

IS MS 

x x a 
I- i-z 



a ce in>eoBBt5BOBOOooooBi-zzzzzz 

-I a nKJJJJJJJJJJJJJJJZHHHHMH 

cm *-a LdZZZZZZ 

-JUJUJ ill V UJUJUJUJUJUJUJUJU1UJUJUJUJUJUJ0.333333 

iaaaaaaaoaa auaacaaaaaaaaaaaaacnu.u.u.u.u.u. 



oo 



oooo 

<E <t <Z <Z 



o o 



ooo 
« «<t 

ooo 

M MM 

ce ce ce 
t— t— i— 

M MM 

ZZZ 

•» firs 

o ♦" CM 

\ s \ 

CO th &• 
OOO 
S V N 

IS CO-0 
IS MS 

O <E> 
CO O i£ 



MOOOOOOOO 

Qmmhmhhhh 

« cece 

oo 
o zz 

m 0. 0. 

ce cn cn 

h- oo 

m xz 

z 0.0. 



ce ce ce ce 
oooo 

: X X Z Z 
0. 0. u. 0. 

cn cn cn cn 
oooo 

X z z z 

0. 0. 0. 0. 



ce ce 

o o 

z z 

cn cn 

o o 

X X 



ce x x m 

i- o o o 

ce u: <e 

cn a a 

3 >- > o 

ce z z m 

o z 

z cn cn o 

o. cn cn m 

cn <e c a. 

o h- i- o 

z o o ce 

0. 0. OL 0. 



ojmxxxxxxx 

oceoooocoo 
_iocecececececece 

I J k- 1 U IU. I M M M a 

oz>>->->->->->- 

oxxxxxxx 
z 
ozzzzzzzz 

033333333 



xxxxxxxxxaaaaaaa 

OOOOOOOOOMHhHMHt-ll-»l-tl-t 

cececececececececeooooooo 
Qaaaaaaaa^^^c<i^^ 
>->->->>->->>->■ 

zzzzzzzzzooooooo 



MOOOOOOOO 

cncncncncncncncnco 



zzzzxzzzxcecececececece 

3333333333333333 

MMMMMMMMMU.U.U.U.U.U.U. 

UUUCJMUMUUJJJJJJJ 

0000000003333333 

cocncncncncncncncncocncncncncncn 



oom 

n I* »m 

N S S 

o <r m 

1M o o 

s s s 

m in n 

is Mv 

j<to 
u. z> s: 



m M 

r-i c j 
X s 

*M CN 

o o 

S X 

w •* 

IS N 
-I -I 

u. u. 



is ci co 

o o ri 

s s s 

is in m 
ooo 

X S, N 

IS IX CO 

IS IS IS 

_l -J z 

u. u. o 



m m 

CM CM 

X X 

>o m 

o o 

X X 

o co 

N is 

<£ Z 

O O 



■*• CNvm M CN -0 

o o cm n ^H »< 

X X X X X X 

ci Mori-o cm 

O O O O O m 

x x x x x x 

IS IS CO CO o ■•o 
is is is is IV IV 

« <x z o _i o 

M 0. I- Z M X 



IS CN MJ IS M IS Cn 

m m o n o pi ri 

x x x x x x x 

cn m oo m n cm «r 

o o o oo o o 

X X X X X X X 

is rs >o co co o is 

rv rs is ms n rv 

x <z m x j x _> 

l-Jtl-lil-Z 



O«NNM»«M».TP)'O(Mn0S 

WOMMMO-MOfJi-I.MOMYMi-1 

xxxxxxxxxxxxxxx 

in M f I PI O O N M") O N N m h m 
OO^mmOO^mOOOOOtMv-ivh 

xxxxxxxxxxxxxxx 

rNffl-O'OCOcoofsco^^rof'jnn 
iscsrsisrsrsisrsMsrsfsrvrsrs 

Z_IKK3><r<tO_l<t>-IMN<t<: 
MU.333O0.ZMO3<C<COO 



o 

o u. 
<t ce <r u. 

I- « I- o 

z z z z 

<t UJ <X h- 

_l UJ _j co 
»- ce k uj 

<I CD « 3 



CO 

zee 

O UJ 
N- M 
COCO 
3 M 
OUJ 

zee 



JZ3 

_i <i cn 

m Em 

m ce 3 
cn o o 
uj o _i 



UJ 

z 
> o 

M CO 
M UJ 

o o z 

I- M O 

zzin ju 
uj m <r m 
x o cn i- z 

_i a. z ce z 
<x « o o 
a. 3 ii u. a 



J£ Z ^ 4 CO 

uj ce o uj uj ui cn mo 

-1 uj o M _| -IUJUJUJZ liikm x z 

_i u i-ji -izcezo co _i o o o o. m z 

mz_iz_!<em<i mmuo« <r_i<tnT _icn ceujvt 

<t z> <r m > _i m ^ x ^z ujujzomuj z uj m o.zzx 

rzu:>j<ici)U)o ceujujzaouj:>a_i_iauja3<icnzuji- 
300cn^ex ujzceui3_i i- r> cn <e<em_i<ioz uj_ioo 

z<xceooocnzzM<ii-ai-i-ocn ua(ooiu.ajJU£>^cuz 
_iz<£cezoce<i>-u.zz<ti-cece3coi-ce <zzm ^^ iii zca j 

<CMXOMce<ruj<tu.<cuj_i<ioujo<c<iuj«<tceMXf-o<iXM<iouj 
a3cno^aza3uj-ioa.iiiu.i>z_ia3'-i_ioo.a.coz303zcez 



is cm «■ •<) <r o co n o- x m is m cn m ut o m m > ^ m r j oo m o> oo co n n m o cn pi r i is « m o m »r 
Miso-o<rr)copiisoMMOOMXM«roi*)MUTUT^Mx>OMMf<)coM>orf)x>ooMCONrN 
o >o <r <m is »r iiT T^ co v pi fl - ri pi >o ^o is is pj «r x m m o- cn pi ti cs x x t co is m *r <i m o ro ro ro 

MOOOOOOOOO-nO^OOOOrtO^OOOOOOOOOOOOOOOOOOOOO 

co>-to>H^rpirHOxuTUixcNMMCNM>OMCN'MCO'r<r<ruT«o«rNP-iOQaPix<rCNCNXMMM 

OOm<mOOO<mOOOOOOOOOOOOOOOOOOOOimmmOmOOOOOm«mm 

xa>onbou^m^xxoaocoxxcococoisxx>omcocoxiscO'0<ocococDNCo«<rr<)ir)roro 

• • • • 



o 
z 
z 
o 
o 

a 
z 
<r 

cn 
cn 



a 

a 
iu 

fr- 
ee 

o 

CO 
UJ 

ce 

<t 

cn 
a 
ce 

o 
o 

UJ 

ce 



-176- 






n 

a 
<£ 
a. 



XXIIXIXXIIZXIIIXIIXIXIXXO.ii.il.IIXX 

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx 



ininninininmbimininininininmininb'jminmifiu-i^omminin^o^ 



OOrSrSOOOOOOOOCMCMCMOOOOOOOCMOrsooOOOCN 
•H »* NNM CM CM 



CM IS CM »< IS CM CM CM CM f J CM NNNN CM CM CM CM CM M « W (N N N N N CM CM IS 
(\j ^ nuNNNMMN CM CM CM CM CM CM CM CM CM h h h N N •* 



_j_j_i_i_i_i_i_j_i_ico_j_icococo_;_i_i 
<r<z<t«c<t«<z<x«a«<ziMai-<i<i<x 

OOOQUOOBOOJOOOJBOOO 



-I -I 

<x <r 

a a 



CD 

is t- 
o- x 



« «««««««<z<z«a«<zrMai-<i<i« «« 

CD OaODOOGOOOJO^OJCOGO O CD 

oooeocunoooooorirtonai^oNOitoooooiniiio 
o Oiiooisotois -ono co o •*■ o n 

w co Nnnnoo'0 cm o .1 oo cm ih cm co 

*4 CM rt^fir) NM rt 



2 
O 
U 

CO 

LU 

o 

X 

« 

a 

co 

UJ 



N 



_l _1 -I 01 *Cfl * 

<£.<£. ae j ocjoc 

h- i- i- o h- a h- 

■r* CM CM CM CM rt CM CM CM CM CM -O CM CM CM ^ 

i1^i£*H**iH*1N-)i1 ^HHHf40iHjH^J^f4r( 

nzzroMMMnn zmr*iror«ir«ir*ii-f*)Zi-ZNor«i fiDZzn 

u««uuuuuui-<zuuuuuuau<io<iuux<ruLe:>-icu 

zi-i-itzitzni-izcritBzi-ai-tirtnzujuz 



-I 0) 

i- _i 
x a. 
Pi 

^ j: {£. 

ro 3 z z r*i 



©oooooo^-ooovooooorjoowoooooooooo 
^•ou*>oooo<ro otooooo-ooocmoooooo o in 

o«oo<ruiiH,-ico o^oonoonnm moo moo m 
■k«k •> *. •. *. k •. •. »■»»«»■» 

CMO o in co »« •■< cm «■« m < -« ao o m 

O i-i CM CM n 



Hi OOOOOOOOOOOOOOOOOOOOOOOO-hOOOOOO 

3 

-J 
z 



UJ 

z> 



z 

UJ 

a 

II 

CJ 

(J 

<z 

a: 



0000000000000000000000000000000 



CCt£.<CaL&.C£.CCCe.Ct.C£.C£.iCCCC£.CLi£.C£.C&t£.i£.X.C£C£.CZi£.CCC£.X.iZCC<X. 

ooooooooooaaooooooaooooocoooooo 

UUUOUUUOCJCJUCJUCJCJCJCJCJCJCJCJCJCJCJCJCJCJCJCJCJU 

zzzzz z z zzz 





-J 




X X X X X 


X 




X 


XXX 




Z 




r 




3 




3 3 3 3 3 


3 




3 


3 


3 3 


LL 0. 




<r 




U 




U. U. U. U. U. 


u. 




U. 


u. 


u. u. 


X 


x x co 




a 




it 


>- 




























x 

Ul 

■> 


t- 


aooaaaaaa 


a a a 


aaaaaaaaaaaa 


a 


a a 


u 


CJ CJ LU 

a 

t- I— M 








Q 


u CJ U CJ u u 


U O CJ 


CJ CJ CJ 


UCJUUUUUUUUCJCJ 


u 


u u 


N- 








O 


<I <Z <Z <I <£ <Z 


<i <x <r 


<z <z <r 


<z«<z«<r<t<z«<z<i<r<z 


<z 


<i « 


<x 


<t <t CC 








C3 


X 
















LU 


UJ UJ 




-0 




z 


X 


u u 


CJ u o 


CJ CJ CJ 


UUUUCJUUUUUUU 


CJ 


u u 


ce 


CC CC -1 




CN 




M 


o 






















m 




D- 


CJ 


a: 


fit LC it u£ l£ 


ic lc i: 


ee ce oe 


itilitKiiitiCLCio; 


C£ 


Lt LC 




CJ 








_l 




3 


3 3 3 3 3 


3 3 3 


333 


333333333333 


3 


3 3 


oe 


u: ce 








O 




u. u. u. u. u. u. 


U. U. U. 


u. u. u. 


U.U.U.LUU.U.U.U.U.U.LLU. 


U. 


U. U. 


LU 


UJ LU U 








:> 




_l 


1 1 — I 1 1 


_l _l _l 


: 1 t 


1 1 1 _i 1 1 1 I 1 1 1 1 


_l 


_i -1 


N- 


t- h- Z 








z 




3 3 3 3 3 3 


3 3 3 


333 


333333333333 


3 


3 3 


<r 


<£ <Z w 




11 




w 




cocncocncococococo 


CO CO CO 


COCOCOCOCOCOCOCOCOCOCOIO 


en 


CO 01 


3 


3 3 N 




CO 




CO 




ncDH-o-o* 


ON O CD 


M 00 O 


i-iocMiiirscM*rfl-o^»-icD 


CN 


-< -0 


H 


m CN M 




Ul 




H- 




*4 


«H o o o r J CM CM o 


cm ca 


N H CJ O O M H PI H O 11 rl 





CJ CM 


— * 


C-J W »H 




n 




z 


UJ 


V 


N V S. V X 


N S V 


v s. *s 


V\SSNV\NNS.V\ 


s. 


s, \ 


s 


S. V N 




oe 




UJ 


H- 


CM IS 111 1*1 ll") CM 


* tfl ■* 


n iii m 


ro in cm co v cm ~ cm is -* m 


-H 


T IS 


rs 


rtiii<) 




2 




a 


<t 


o 


o o o o o 


O O rt 


000 


OOOOOO^HOO'i-rtO 


rH 


O O 





000 






M 


a 


s. 


V. N N S> S. 


V S. V 


V S. V 


N'SSSN'VS.SN'SS.N. 


S 


s> s 


S 


s. s. v 






U 




•o 


tttna 


IS IS -0 


CO IS IV 


ts-ofsrscDoorscocDCDCDcoroinin 


T 


CO CO 




^^ 




z 

IH 




IS 


rs IS rs IS IS 


IS IS IS 


IS IS IS 


isisrsrsrsisisisisrsrsis 


IS 


is rs 


rs 


ts is rs 


• 


* 




z 


OON J«N 


JNiZ 


J«N 


J2«XO«INJt-NJMf)>lCNJX 


* 
* 
* 


* 
* 






a 


CJ 


r « u. o. <z 


hi<E <I 


u, cj <r 


ni-iLI-000<Zii3<t<X3Xi: 


O <t n H 


























» 
* 
» 
* 

4t 


rs 
rs 






u 




X 






















o 




CO 






















-1 




CO CC 


CO UJ X 


-1 z 








a 


* 












UJ 3 


11 _l 


CJ 


a _i z uj <z x z 








>• j 


* 








H. 


1- 


-j a 


_J -J 


<t CM 


ZnO_l<ZZZ <ZUJ 




<c 




Of UJ 


■# 


H 






z 


z 


B«(OOOhH 


UJ UJ H 


<txi-_it-<zo3x_izcn 




w X 




oe hi 


• 








UJ 


o 


i£3l-N 


a. o => 


a ■z.a 


_i ae ee « 11 i-oa_ioz 




z <r 




Ul t- U. 


* 


CO 






a 


c 


X O 1- i-i 


o a co 


n n 


_JUJUJ L£<tl-_JZ<tKUJ 


LU 


O CJ 


Of 


a n 2 


• 


I 






M 


Q 


uj u. u >-i o: 


ce w m 


a t— n 


Ou.XI-3l-<t3wCOU.^ 


_l 


N- 3 





^Z3 


4* 


>- 






o 


z 


_j u. -^ a. ijt 


1-0:3 


iC iCSZ. 


lu. JKhZiCOL. huj 


_l 


z a 


>- 


cj j: 


* 


<z 






z 


o 


<z « « <r 


UJ UJ UJ 


U <E Ul 


0<tO««HL<IJh 


LU 


LU <Z 


l£ 


<C 3 cc 


» 


UJ 


o 

CO 

CN 




ii 


-J 


CO CO _l 3 O 


x 0. _l 


z> xo. 


CDUa.O.ZtOCDCDUJ_J(JCO 


a 


a a. 


O 


x co a 


* 


a 




o 


<r 


<r <z <i <r <r 


<z <z <z 


a <i <r 


<r<t<z<i<icj«<t<z<i<z<i 


<r 


<Z <I 


a 


<Z <I N 






— 1 




z 


0- 


>o n h < » 


is r j 1 


co 00 ro 


M CI CN CN CN N -1 CN CM O 00 f J 


CM 


CI CI 


CI 


ci t «r 


* 


•* 


1 






00 


O-OMflH 


00 rt M 


^ M CM 


fS-OCN-OISfSrtCOIiTW^CN 


CO 


&■ CM 


•0 


IS >0 CN 


» 


EO 


in 




1- 


m 


•o cm cm -o r-i 


m ui 


cn «r iiT 


oisrHoisro«rtnoo-iM 


M 


T -1 


tn iii n 1 


• 


-1 


i-i 




ce 


o 


o o o o ^ 


000 


000 


^OOOOO'HO'IOihO 





O O 





000 


* 


<I 


i 




o 


M 


mo n m n 


itj-oh 


•<r -0 <o 


nuino<rrO'irois-<rtN 


t-t 


111 00 


rs 


cmt <r 


• 


H- 


z 




0. 


O 


o o o o o 


001 


000 


0OOOOO»^OOi»hO 


tH 


O O 





000 


* 


O 


<£ 

"J 




Ill 


"Ov^^inoiNis-ocDisNrv^isisoocoNCDCDcocDconinin 


<r 


CO CO "O 


» 


1- 



CO 
UJ 

a 
o 

CJ 



a 
o 
x 
x 
o 

CJ 

a 
z 
<t 

CO 
CO 

•x a 
-1 z 
cj 3 

>■ £ 
a 

ci 
a a 
ui eg 

H- 3 

ClC w 

co !; 

ui 

ue -* 
<t -1 



-177- 



BMCS REPORTS 



Current 















Inju- 


Dollar 


Amount 


Bate 


City 


State 


Commodity 


Class 


Deaths 


ries 


Damages 


Released 


02/04/76 


New Castle 


DA 


Fuel Oil 


Comb L 


3 


3 


22,000 


UNK 


01/23/76 


Cannon Falls 


NM 


Fuel Oil 


Comb L 








7,000 


UNK 


11/22/73 


New Cumberland 


PA 


Fuel Oil 


Comb L 


2 





320,000 


UNK 


02/22/74 


Camanche 


TX 


Fuel Oil 


Comb L 


1 





27,000 


UNK 


03/28/74 


Beckly 


WV 


Butyl Chloride 


F.L. 








14,000 


UNK 


04/08/75 


Rodeo 


CA 


Fl. Liq. N.O.S. 


F.L. 








7,000 


55 Gal 


04/10/75 


Sun Valley 


CA 


Fl. Liq. N.O.S. 


F.L. 





4 


120,000 


UNK 


05/16/76 


Massie Twnshp. 


OH 


Fl. Liq. N.O.S. 


F.L. 








30,000 


UNK 


12/05/73 


Eastland 


TX 


Gasoline 


F.L. 


1 


1 


15,000 


UNK 


09/08/73 


LaGrand 


OR 


Gasoline 


F.L. 


Mr 1 





50,000 


UNK 


01/17/76 


Sacramento 


CA 


Gasoline 


F.L. 


5 


11,700 


UNK 


10/18/73 


Kansas City 


MO 


Gasoline 


F.L. 


2 





1,000,000 


UNK 


10/07/74 


No. Platte 


NB 


Gasoline 


F.L. 


1 





250,000 


UNK 


01/17/74 


Plainfield 


IL 


Gasoline 


F.L. 


1 


1 


55,000 


UNK 


12/13/75 


E. Hartford 


CT 


Gasoline 


F.L. 





1 


25,000 


UNK 


01/26/76 


Enfield 


NH 


Gasoline 


F.L. 








10,000 


UNK 


07/06/76 


Kansas City 


KS 


Gasoline 


F.L. 





2 


75,000 


UNK 


01/08/74 


Los Angeles 


CA 


Gasoline 


F.L. 


1 





295,000 


UNK 


07/27/74 


Epsour 


NH 


Gasoline 


F.L. 


1 


2 


3,000 


UNK 


01/18/76 


Windham 


NH 


Gasoline 


F.L. 


1 


4 


25,000 


UNK 


08/23/76 


Manila 


VT 


Gasoline 


F.L. 


1 





40,000 


UNK 


01/20/76 


Falmouth 


ME 


Gasoline 


F.L. 





1 


24,000 


UNK 


06/12/78 


Des Moines 


10 


Paint 


F.L. 


1 


1 


50,000 


UNK 


07/24/76 


Green River 


VT 


Ammonium 
Nitrate 


Oxidizer 


2 





50,000 


UNK 


04/27/76 


Brisco 


AK 


Nydrogen 
Peroxide 


Oxidizer 





1 


34,400 


UNK 


01/08/76 


Gallop 


NM 


Butane 


F.G. 


4 


3 


50,000 


UNK 


08/06/76 


Kansas City 


KS 


Fl. Comp. Gas 


F.G. 








30,000 


UNK 


05/26/76 


Portland 


MI 


L.P.G. 


F.G. 





1 


8,000 


UNK 


04/17/75 


Becket 


MA 


L.P.G. 


F.G. 





1 


7,000 


UNK 


02/13/74 


Gainesville 


GA 


L.P.G. 


F.G. 





1 


9,200 


UNK 


08/27/74 


Kansas City 


MO 


L.P.G. 


F.G. 








10,000 


UNK 


05/22/74 


Golden 


CO 


L.P.G. 


F.G. 





1 


14,000 


UNK 


09/28/73 




TX 


Poisonous Sol. 

N.O.S. 
High Explosives 


Poison B 


1 





63,200 


UNK 


02/01/76 


El Reno 


OK 


Expl. A 


2 





76,000 


UNK 


08/08/74 


Chicago 


IL 


Caustic Soda 


COR 


2 


10 


15,000 


UNK 


11/07/75 


LaFayette 


IN 


Sulfur Trioxide 


COR 


1 


1 


52,000 


UNK 



-178- 



APPENDIX C 

PLOTS OF THE QUANTITY SPILLED VS. CONSTANT 
DOLLAR DAMAGES (1978) FOR HAZARDOUS MATERIALS 
INVOLVED IN 10 OR MORE HIGHWAY ACCIDENTS 
BETWEEN JULY 1973 AND DECEMBER 1978 



Note : The data for these plots were derived from the MTB computer printout 
in Appendix B. A complete listing of the quantity spilled and constant 
dollar damages for every hazardous materials accident reported be- 
tween July 1973 and December 1978 is in the possession of the Federal 
Highway Administration. 



-179- 



Aiconci NO.S 



60,000 



50,000 - 



40,000- 






30,000 



20,000 



10,000 
1,000 

e.ooo 

4,000 
2,000 



El 



Anhydrous Ammonia 



70,000 - 



rifar 



1,000 2.000 3,000 4.000 5,000 7.500 

QUANTITY PELEASED (GALLONS) 



_L 



10.000 



20,900 — 



10,000- 
8,000 - 
M00- 

4,000 - 
2,000 - 



1,000 2,000 3.000 4.000 5,000 7,500 

QUANTITY RELEASED (GALLONS) 



10,000 



Asphalt Cut Back 



50,000 - 



40,000 



30,000 



20,000 



10,000 - 
8,000 - 
6,000 - 
4,000 - 
2,000 - 



1,000 2.000 3.000 4.000 5,000 7,500 

QUANTITY RELEASED (GALLONS) 



10,000 



cr 


CO 


5 






i—i 


o 




Q 


B 


1- 


Ui 


i 


< 


w 


CO 


vt 





40,000- 



30,000 



20,000 



10,000 - 

8,000 - 
6,000 r 
4,000 - 
2,000 - 
OJ*- 



Acetone 



1.000 2,000 3,000 4.000 5,000 7,500 

QUANTITY RELEASED (GALLONS) 



-180- 



Comoustiple Liquid N.O.S 



Compound Paint Remover 



tr oo 

< t^ 

-J cn 

-J fH 



40,000- 



30,000- 



20.0001- 



10.000 • 

a.ooo - 

8,000 
4,000 - 
2,00i 



25,000 



uj 20,000 



13 (6)j . 



_|_ 



1,000 2,000 3,000 4,000 5,000 7,500 

QUANTITY RELEASED (SALLONS) 



10,000 



15,000 



10,000 



5,000 
4,000 
3,000 
2,000 
1,000 
-( 



_i_ 



— 500 1,000 1,500 2,000 3,000 4,000 5,000 

QUANTITY RELEASED (GALLONS) 



Compound Cleaning Liquid C 



30,000 



25,000 



20,000 



15,000 



5,000 
4,000 
3,000 
2,000 
1,000, 



,0- 



_L 



_L 



_L 



<r oo 

< r>- 
-J oi 



Corrosive Liquid N.O.S. 



50 110 150 200 250 300 350 400 4S0 500 

QUANTITY RELEASED (GALLONS) 



50,000 






• 




40,000 










30,000 


- 




• 




20,000 










10,000 










8,000 










6,000 
4.000 


r • 

• • 








2,000, 


mY » , , , 


I 


J 


1 


"S 


(-^ 500 1,000 1,500 2.000 


3.000 


4,000 


5,000 



QUANTITY RELEASED (GALLONS) 



-181- 



at oo 
< r^. 

-J CT> 





Flammable Liquid N OS 




70,000 


• 




60,000 


• 




50.000 


• 




40,000 


• 




30,000 


• 




20,000 


•• • 




10,000 






8,000 


i 




6,000 


• • • 




4,000 


• 
• 




2,000. 


8) i . J- i l 




f~ 1,000 2,000 3.000 4,000 5.000 7,500 


10,000 



Fuel Aviation Turbine 



QUANTITY RELEASED (GALLONS) 



Crude Oil Petroleum 



\ (♦627,634) 
I W92.106) 



70,000 



60,000 - 



40,000 



.- 40,000 

. °> 

a ■ 



*3 



30,000 



20,000 



10,000- 

8,000 1- 
0,000 



6,000 - 

4,000 L 

2.000 h 

nlu 111 



-. I ' ' ■ 

1,000 2,000 3,000 4,000 5,000 



7,500 

QUANTITY RELEASED (GALLONS) 

Fuel Oil 



_L 



10,000 



70,000 



60,000 



50,000 - 



a: co 40,000 



30,000 



20.000 



10,000 
6,000 
6,000 
4,000 

2,000 



Pi 



.oouVdoo 3.000 4,ulflJ ?,06 



r ^T 



2.000 3.000 4T8B9 ?,o6o " 7.J 

QUANTITY RELEASED (GALLONS) 



I 



10,000 



t. 



t ((254000; 



60,000 



50,000 



40.000 



2 J 30,000 



20,000 



10,000 
6.000 
6,000 
4,000 
2,0i 



(1214,000) 



r(>hm, 



2,uim 3.aoi 4,oJ3 J.dOO 



rdoo 2.U00 3.000 4,dJ3 i.iii " T$SS 

QUANTITY RELEASED (GALLONS) 



10,000 



-182- 



Fuel Oil 1.2.4 5 



Liquid Petroleum Gas 



BE CO 

3S? 



1 i 



•0.000 



70,000 



60,000 



50,000 



40,000 



30,000 



20,000 - 



10,000 - 
1,000 - 
6,000 (- 
4,000 
2.001 



70400 



HO.OO0- 



t (tiMJH) 



K CO 

■J o> 



§ ■ 40,000 

% 



1 

3 



r;ooo 2,000 3,000 4.000 5.000 7,900 

QUANTITY RELEASED (GALLONS) 



10,000 



M.OO0 



20,000 



10400 
1.000 
6,000 
4,000 
1400 

0, 



,1 • I I «l • . 

1.000 2.000 1.000 4.000 5,000 



7.500 1Q.00O 

8UANTITY RELEASED (GALLONS) 



Hydrochloric Acid 



40.000 



£ 30.000 

D 

i 



« 00 

< r-» 

-I C7V 



20,000 



5 3 



10.000 »- 
6,000 - 
6,000 - 
4,000 - 

2,000 - 
ol^-s. 



Oil NO S 



40.000 



30.000 



IT 



500 1,000 1.500 2.000 3.000 4,' 

QUANTITY RELEASED (GALLONS) 



sfor 



M.000 



10.000 
6.000 
6,000 
4,000 
2,000 



TSbV 



1,000 2.000 3.000 4.000 5,000 7.500 

3UANTITY RELEASED (GALLONS) 



10,006 



-183- 



Sodium Hydroxide Liquid 



•<U»0 



80.000 



70,000 



60.000 



50.000 



tx oo 

< r** 

-I <T> 



a 40.000 



30,000 



20.000- 



10,000- 
8.000- 
8.000- 
4,000- 

2.1 



Paint, Enamel, Lacquer, Stain 



nF 7 500 1,000 1 



SOO 2.000 3,000 4.000 

QUANTITY RELEASED (GALLONS) 



5,000 



<r oo 

-I —I 
o 
a • 

h- w 

5 3 

t- CQ 

s 



40,000 


• 










35,000 












30,000 












28,000 












20,000 


'x- 










18,000 


1 










10,000 












8,000 
4.000 
3,000 
2,000 

1,000 


• 

• 


• 
• 

1 1 


• 

1 


i 


1 


1 SOO 1,000 1,500 2.000 


l.ooo 


4,000 


5,000 



QUANTITY RELEASED (SALLONS) 



Sulfuric Acid 



30,000- 



28,000- 



2 20,000 



<C 00 

3r». 
en 

a ■ 18,000 



10,000 



8400 
4.000 
3.000 
2,000 

1,000 



a. 



ji i • i 



j_ 



500 1,000 1,500 2.000 3.000 4,000 

QUANTITY RELEASED (GALLONS) 



5,000 



-184- 



GASOLINE 



<u 
oo 

c 
eg 
| 

CO ^N 

a oo 



160,000 



80,000 



40,000 



20,000 



u (0 

B PQ 

U 
M 

C 

o 
u 



10,000 



5,000 



1,000 


















5 








1 


1 


7 


5 


1 


1 

1 
i 





6 


19 


21 


2 





6 


6 


19 


10 


2 


2 


6 


5 


13 


4 


3 


1 


6 


9 


12 


7 


12 


4 


13 


31 


47 


14 


63 


15 


14 


17 


15 


7 



500 1,000 2,000 

Amount Released (Gallons) 



.,000 



8,000 16,000 



-185- 



APPENDIX D 



WORKSHEET 1: 
ROADWAY INVENTORIES FOR THE FOUR ALTERNATIVE ROUTES 
IN THE WASHINGTON, D„ C. , CASE STUDY 



as 

e 

f- 
z 

> 

z 

< 
o 



35 



rS •= & 



E 














a 
Mi 

BE 

W Ml 
t— «•) 

SgE 

w £ -2. 

1 

Mi 


m 


-a- 


-3- 


in 
•a- 


m 
in 




m 


X 


- 1 


l 


1 


l 


1 




cc 


1 


l 


1 


i 


1 




an) 


1 


1 


1 


1 


1 




II 

3D 

g| 

x§ 




1 


' 


1 


l 


' 




* 


1 


I 


1 


l 


1 




as 
u 

to 


2E 


1 


l 


1 


.' 


' 




* 


' 


' 


1 


' 


1 






d 


CO 

oo 

oo 


O 

•H 
O 


00 


o 
in 






m 
in 


; 


: 


r 


in 
m 




3 


o 


ro 


o 

CI 








is- 

= § = 


C 


: 


r 


- 


u 

3 




2 *> 

E 


^0 


vO 


v£> 


VO 


vO 




OC 1— 


1 


co 
l 

H 


to 

1 


CO 
1 

h-l 


CO 
1 

M 




£ 


o 

5 


^0 >« 

j- in in in w: 
E o> c* . OMica 

^ M M "^ WH6IPS 


g o) ore .. • 

■^ H Mb! H OS 


C 1 

« J= 

• • -H "3 60 >, 
"O 11) -H tl) 

.—1 T" 


• m 

.. B C 

„ C 0) 

M Pu < 


6 
m m 
.. & 

M M OS 


- 


* 


< 

1 


D3 
1 


1 

.— 1 


Q 
1 


w - ■ 








-186- 



> 

O 
f- 

2 
U 

> 

< 

< 
o 



V. 

C 



£ •> *> 
JS ■= oe 

«t o &. 



ejf' 

E 

£ 














e 
S , 

at 

•— v> 

SSf 

£ ° 5 

*■» B£f -5- 




-a- 


<3- 




rl 
m 

tN 


(Nl 

m 

CM 


s 

■E 


X 


1 


l 


1 


1 


1 


1 


oc 


1 


i 


1 


l 


1 


1 


- 


l 


i 


r 


l 


1 


. 




a 


1 


l 


i 


l 


I 


1 


* 


l 


i 


i 


I 


1 > 


1 


u 
■s 


5 

■c 


l 


l 


i 


: 


1 


' 


% 


1 


i 


' 


i 


> 


1 




in 

d 
o-> 


00 

oo 

00 


i_- 
o 


o 

~3- 


m 
m 


oo 




m 
m 


: 


= 


- 


- 


m 
m 


3 

K 


o 
m 


m 


o 


m 


CO 


oo 
en 


si* 


c 

TO 


s 


= 


= 


r 


= 


2 "> 

Is 


vO 


vO 


vT> 


-3- 


«3- 


-3- 


O w 
« ft. 


CO 
1 

M 


CO 
1 

M 


to 

1 


tO 
1 

1— 1 


to 

1 

M 


to 

1 


E 

X 


o 
5 


— mm , __ 
o 2 5" 4,c - ( ' 

MV lOHUC 
b- M mH UPC: 


Pi 


C 1 

TO X ^ 
• • -H t3 00 TO 
tJ TO -H 3 
H C O X 


ij 

m I ai 
£ 1 "* TO u 


1 ^ 

■•uti a 

C -H c 3 
H 3 TO 1 


1 

O TO 

•• C u • 

C C C V 

E- — < « > 

X < 


* 


< 
1 

CM 


1 


u 

1 


a 
i 

CM 


1 

CN 


C 
i 



-187- 



a 
© 
H 
z 

a. 

> 

z 
< 

© 
a: 



© 



•s -S ~ 































£ 














e | : 










































„ - 














* £ 














8 I 




























£ 














_ 














e 




























m 




























Mrf W 














»» *"> 














« CD -=" 














-O E 
















r^ 


o 


o 








e a S 


CM 


CI 


CM 








u s; — 

* X 


O 


-a- 


«* 










CM 


co 


CO 








K 










-"V 




w 










I, 






X 


1 


l 


1 








K 






























S 
















m 


•c 


1 


1 


1 








ts 


















- 


1 


i 


1 










ul 














































w^) 


X 














11 


55 


1 


o 


o 








SC 


Cb. 














* W 
















il 


* 


1 


o 


o 
























































Sc 


X 
















cc 


1 


o 


o 








R 


2? 














W 






























i 
















ac 


















* 


1 


o 


o 










CO 


o 


m 






















s 
« s. 


o 

SO 


o 
m 


CO 








£ X 


in 
in 


m 


m 
-a 








5 

IS 


«tf 


CO 


\o 








m 














3 


»H 


CM 


CM 








■ 














ill 

• is 


C 

re 


. 


- 






















5 *» 
I S 2 


-a- 


•3- 


-a- 








K 














a *-> 


v> 




— c •*" 

5 . -H 








Is 


i 


» < ji 


* ^ H 

3 < 2 






















^J © 














o 


>,m 


•• i 










K 


3 « • 


o -O p . 










5 


H i 5 <u 


f- C 0) 0) 










X 




03 1 4J 


w > > 










u 




s- ci 


J < 










*P 


O 


•x 


»— i 










CM 


1 

CM 


CM 









-188- 



>■ 
at 
O 
(- 
z 

> 
z 

< 

< 
c 



JO g. 

ae 
z St 








01 

o 

c 
re tA 

i- a 
u e 

C Q 
01 u 

VI 4J 

3 1H 
X 

U 01 
01 

E T3 
3 C 

z re 




Sharp turn under 
1-295 where 1!C 
carriers reverse 
direction 


e 

ae 
a e K 

U ff — 


NO 
ON 

vO 


cm 

CM 
CO 


ON 

m 

00 


00 
00 


On 
-3- 


CM 
CM 

o 

en 


S 

■E 


s 


1 


1 


l 


1 


1 


1 


QC 


1 


1 


l 


1 


1 


1 


- 


1 


1 


1 


1 


' 


1 


Is 


w 

5 


' 


1 


' 


1 


1 


1 


* 


1 


' 


I 


1 


I 


1 


■E 


DC 


1 


1 


l 


: 


1 


1 


* 


1 


1 


I 


■ 


I 


.! 


I I 


On 
O 


-1 
CI 

CM 


<3 

CM 


ON 

CM 


in 


i 






S 


z 


S 


= 


i 


19 




in 

CM 


in 

CM 


eo 


O 
m 


C 


ill 


c 
re 

1j 

3 


r 


; 


: 


. 


: 




nC 


NO 


NC 


NO 


<T 


-? 


Is 


CO 


CO 
1 


CO 


CO 

1 

M 


CO 
1 


CO 

1 


K 

S 

19 


a 
o 


-3 JJ 
" in in a) 

E ON On •• 01 Oi 

O en -a- o ^£ u 

U 1 1 H 3 JJ 

U. M M P CO 


4-1 

01 

•• 00 01 

C t* 

H -H 4J 
M CO 


c 

•• 1 • 

O J= 4-1 -c 

H m 00 > 

re e -^ 

2 — I CD 


<J 01 
01 00 

••.sot? 

O il Uvl 

H •* •" »j 

-^ CO CO 


" *> in 

,- ? M £ 

• • jr oi -5 X, 

O 4J l- -H | 
H — < *-• k- 4i 

— ■ CO CO ufl 


1 >. 

• • *J -u c 
-H C 3 
E- 3 <r 1 

CO — i. 


fc 


< 
1 
en 


co 
1 
m 


o 
1 
m 


c 
1 

S3 


til 
I 


1 



-189- 



> 

OS 

O 
H 
Z 

> 

z 

< 

a 
< 
c 



as 



* * 

E 














e 

HI 

ss 
SSf 

a e B 

ft 


CM 
CM 


CM 

O 

CM 


o 
en 

-3 


o 

CM 

-3 

en 


i^/ 




s 

ac 
m 


2 


1 


- 


l 


i 






- 


1 


1 


l 


1 






- 


1 


1 


l 


i 






P 


X 

l_l 


1 


1 


o 


o 






* 


1 


1 


o 


o 






5c 

« 
an 
U 

■E 
BE 


£ 

tat 

a- 


' 


1 


© 


o 






* 


1 


1 


o 


o 






S I 


CO 


d 


d 
d 


m 
m 






e _ 

£- 


m 


= 


in 

■a- 








£ 


00 




en 

CM 


CM 






ill 

«/5 


c 

=3 


: 


= 


= 






" ft £ 

K 


-a- 


-3 


-3 


-3" 






it 


1 


C/3 
1 


5 <o 

^ I- 1 m 

D < 2 


5 <o 

* ^ & 






s 


a 
5 


1 

.. 0) 

o c « • 
H C u tl 

•H > 


o 

.. . « 

O '-3 3 fe 

H 4J II 

Bi CO Cu 


•• 1 

T3 >J • 
H C <D 0J 

CO > > 

.J O < 


O 

m m 
.. o> 

0-3 <u 

H 1 >« 4J 

m a! 






* 


1 


1 


M 
I 

n 


<-> 
i 







-190- 



> 
a. 
o 
H 
z 

> 
z 

>■ 
< 

B 

if 

K 



a: 

a: 



































£ 
















£ jf- 
































K *^ 
































* "5 
















* a 
















8 I 
































£ 
















e 
















































ac 
















U-r tu 
















ta. V» 
















« CD ■=■ 
















Eg e 


00 


-a 




t~. 


o 


-a 


o 


vO 


u-> 




o> 


CM 


r- 


00 


£ O S 


t» 






— < 


CM 


on 


m 


















U c "" 


-h" 


CM 




CM 


CM 


•H 


m 


















K 


































Z 


1 


1 




1 


1 


1 


• 


K 




















































■c 


ae 


1 


1 




1 


1 


1 


l 






































- 


1 


1 


1 


1 


r 


l 




rjj 


































W^ 


2 














r*. 






1 


1 




1 


1 


i 


m 




■" 
































Si 


* 


1 


1 






1 


i 


oo 




a 














vO 


■ 


s 

DC 


1 


1 




1 


1 


i 


m 


13 


















<s> 


»■ 










• 






U 








































































£ 




















^ 


1 


1 




1 


1 


i 


m 




cq 


PM 




<3 


— 4 


r^ 


CO 


s i 


o\ 


PI 




r** 


CT\ 


vO 




o 


CM 




CM 


CM 


O 


vD 










_H 


F— < 


•— < 


in 


-1 


in 


in 




m 


m 


in 


m 


*n " - 


U1 


in 




U1 


m 


in 


•a 


s 
















5 


r-~ 


m 




oi 


00 


ON 


•a 


E 
















3 


(V) 


CM 




CM 


— 


CM 


~^ 


~i~ 


C 
I re 










c 


c 


ill 


•O .o 










.c 


J3 


3 P 


: 




= 


= 


1- 

3 


a 


2 v> 
I 6 5 


vO 


vO 




vD 


M5 


vfi 


>3- 


■ 


















iJ rt 


s 


: 


= 




2 1 -H 

u h w 

£ < oj 






• • t^J JJ 


4J 


u 


•• 4-1 C 


4J 0) 


>*B O 


i 




e 


gin m o> 


.. J) 


0) 


g 01 10* 


01 BO 


oi m 


•U >i 


E 


0O> On •• 01 4) 


E 0) o) •• 


60 01 


O O00I ".C 4J T3 


J= 0) "O 


CO • • 


•• cu ft) 


o 


pm sr o.*: p 


Cii P O 


C U 


U CP Sul BO > 


.. 4J Id "H 


..3i4<u oi 


0) 3 


3 




hi IH3U 


(j 3 jj H 


•H4J 


tu tH4J H«Ch 


<■ iJ u 


O0l0)5> 4J 


H PO 1 


19 




M M OC/5 


fnOC/3 


S*!c/3 


!«**> 2-H M 


H — i w eo 


Hzrx! ei 


035 Cm 


* 


1 


03 




o 


O 


H 


b 




•a- 


1 

-J 




1 


-» . . 


•a 


1 



-191- 



C 

z 

> 
z 

c 
< 
c 



fr- 
it; 
u 

35 
as 































£ 














s |. 




























K - 




























* "S 














§* 














"I 














«. 














o 














Hi 














» 














■C 




























f— «--) 














« a •=■ 














■B S f 














K g | 


o 


© 


O 


o 






g o B 


CM 


en 


m 


CM 






00 


-3 


-3- 


•3 




















s|" 


«3 


m 


o 


en 


































V) 






























s 




, 


l 


l 






K 
















































•c 




1 


1 


1 






































- 




1 


l 


l 








Uj 














































i+l*f> 


s 


U1 












§1 


K 


• 


O 


o 


o 








in 












© S 
































»•* 
















ii 


* 


CM 














'—' 


o 


o 


o 








bbJ 














































■c 


s 


00 














QC 














(9 


k 


— 


o 


o 


o 






c_> 
















































m 
















m. 


















* 


-3- 


© 


o 


o 








ffv 


CM 


© 


!r\ 




















° p 


CI 


vO 


o 


r^ 








vO 


in 


m 


ei 






£3 


in 


in 


m 


m 






•« — 


-3 


-3 


-3 


•3 






13 


CM 




m 


VO 






E 














S 


CM 


~* 


CM 


CM 






ill 


c 
to 

XI 


_ 


. 


. 








Li 












I s - 


-3- 


-3 


«3 


«3 






9 -^ 














■ 














e w 


J, -3 












« fc. 


x | T] 












c :» 


£$* 








































TO 






O 








s 


x; -u 


>> 


1 


in in 








.. u 0- • 


re 


.. ~o U • 


.. o\ 






£ 


o 


C D^ » 


o 3 $ 


C 4) "O 


<T <J3 01 






X 




H TO > 


H 1 1 


H TO > es 


H 1 4J 






3 

■A 




w O < 


03 ft. 


J 


M OS 






fe 


1 


X 


M 


T> 








-3 


■» 


■* 


■* 







-192- 



C/3 

O 



CQ 

o 

OS 

On 

Q 
& 

w 

H 
<< 

05 

til 
Q 

NH 

u 

NO 

H 

W 

w 

X 

& 

OS 

o 



> 



a 
e 
5e © • 

£ « a 

< a q. 



m 

< 

00 

O 

oc 

EL 



E 

> 

E 
o 

z M 

UJ £ 

QO 

a 
E 

«> 

UJ 



z 

s 
o 
111 

(0 



UJ 

a 
o 



E 

"5 E o 

o> r 

CO *" X 
vO O 

M in °° 
II II 



u 
u 

CD 



m 



o 
on 


g 


>-• 





cm 


**^ 


i—i 


O 


o 


cj 


• 


cd 


+ 


^o 




en 


m 


m 



II 

>■ 



< 
I 



H 
(U4J 

vo 



I 
co 



E 

p£« 

o ? ° 
o > '" 

CD w X 

<>0 CO ■— I 

m *~ ' o\ 

if 



■jf 



o 
o 

cs 



E 

if 

fl o 

vO . 

VO CO 



o 
u 

•S 

ST 



5 

00 

On 



oo 



00 
00 



cs 

I— I 

o 

+ 

m 

<t 

• 

II 

>■ 



o 

CJ 

cd 

vo 
.— i 
m 



PQ 
I 



I 

3 
CO 



^0) 
(UJ-) iH 
CO) cd 
cd4-> Vj 
iJw 3 



3 
cd 

3 



vD 



Oil 43 



CM 
i— I 
O 

+ 

m 
<t 

• 

II 

>- 



a 
o 
cd 

CM 

vO 



Li 

OJ , 

d =» 

M QJ^ 
CJ U.-H 

d td cd 
cd 4J Lj 
■-J co 3 

vO *w 



£-54 

in* <t iS 
co • oo 

■sf VDH 

ii n 



u 
o 



CM 

00 



CM 



m 
<t 



II 

>- 



cj 

o 
cd 

m 
co 



I 



I 

3 
CO 



CJ-Ui-H 

ded cd 
cd-u u 
hJco 3 



d 
cd 
£> 

to 

3 
X> 



E 

1 

is 



& 

m 



E o 
i *■ 

T x 

• 00 

r- q 
X • 

CM 



O 

o 

CD 



m 

CTi 



CM 

o 



m 

<t 



II 

>- 



CJ 

o 
cd 

o 

CT> 

m 



w 



u 

0) . 

d => 

£ co 

M <U-s 

d eded 
cd-us-i 
hJcos 

\0 N-^ 



•5 o £ 



• • c * • -g 

2 tj o o o 2 

"S o = S Z o 

ob • c » > a. 

II ll li ll II II 



^ » E E 8 

•o c c > S 



-193- 



CO 

Z 
O 

H 

< 

U 

-J 

< 



CQ 
O 
Q 

< 
OS 

Z 

w 

Q 

i— < 

u 
o 

< 

o 

H 

Cd 
UJ 
S 
CO 

as 



CN 



> 



CN 



fe ® • 

2: CO CO 

< Q O. 





E 


E 


E 


E 


E 




> «* 


> «c 


> *e> 


> •o 


> «" 


>- 


E-|« 


E-i? 


E-|<? 


£•!• 


E|* 
"5 E 


"S E 


■5 E 


? 2 


?2 


j 


> *" 


> *" 


i r 


A^ 


i*" 




CD "-' K 


CO *-" X 


«B w X 


CB *"*' K 


H CO «J 


s 


vO O 


<£> CO r-> 


NO * 


O TH VO 


< 




i-h • r^ 


v£> — t 00 
vo ^ 0\ 


^ en* ** 


^ x en* 
II IT 


CD 
O 

cc 


in >— i <rs 


vO l ' 1— 1 


II II 


*"* 


if *lf 


if K if 


0. 





5" 




5" 



5" 


5" 














O 


u 








0. 


to, 

a. 


<o 














? 












> 












E 






/—* 






ATE 
id (ace/ 


/"■ \ 


*~\ 


O 


»->i 


^^' 


m 


00 


• 





m 





• 

00 


1— 1 
O 


• 

en 


m 




00 


1— 1 






cc 5 








g 






CM > 


CM > 


CM > 


a > 


B 


-< B 


^ B 


^ S 


CN B 


CN > 


**». 


**- 


O "-- 


-» 


s 


UJ X) 


CJ 





O 





• ^**H». 


O O 


a 














8* 


+ « 


+ m 


+ ca 


+ c« 


cd 


m vo 


m v£> 


m cm 


O O 





<? 


-* en 


•<* ^ 


«sT vO 


00 vD 


00 t-i 


• m 


m 


v£> 


• *£) 


• t— 1 


*» 


• 


• 


s 


• 


• 


«0 

E 

55 


1— 1 


1— 1 


1—1 


»H 


CM 


II 11 


II 11 


II II 


II II 


II II 


«o 












UJ 


>■ 


>- 


>■ 


>■ 


>■ 


K 












Z 












UI 












S 
o 

UJ 


< 


PQ 




1 


P 

1 


W 


CM 


1 

CM 


1 

CM 


1 

CM 


CM 


(0 










1 




U 


U 


i-t 


U 


i-( 


-J 

UI 





<U , 


a> , 


ai . 


Q) 


CD 


V c 


a * 


£ CO 


U 

3 


4-1 

3 

H a) *~n' 


<DW H (8 


CD-Uli-H CCj 


OJ4J i-l Cd 


QJ 4J 3 


a) -ui 3 


S 


3 cd cd ,0 


3 cd cd ,o 


3cd cd ,0 


3 cd co 


3 co cd 




c0 4J J-i Vj 


cd -u ^ j-i 


ctj-u U U 


cd -p ,a 


Cd 4J JD 




kJ w 3 3 


.-J co 3 3 


h-Jw 3 3 


l-J CO u 


tJ CO »-( 




Ctf ,0 


Pi ,n 


a & 


t=> 


!=i 




vO ^^ 


v© s-/ 1 


vo N -^ 


sr •^ 


«tf ^ 



J • 2 

§ 1 " 

• • c • • -o 

■o 2 £ Si ° I 

u o = £ £ e 

■ ■ E > 5 a 



11 11 11 11 n 11 



» 8 I ? 

■ E > 



-194- 



CO 

iz; 
o 

H 

< 

P 
<J 

< 



CQ 

1 

O 

05 
ft, 

Q 
Z 

OS 
H 

H 
Q 

u 

so 

H 
W 

W 

s 

CO 

o 



eg 



e 



CN 



CM 



• So 

2S CO « 
< Q O. 





E 


E 


E 


E 






> *c 


> "C 


> *C" 


> ^ 




>. 


£•!• 


E-|» 


E-g* 


E|« 




£ 


"cjEo 


o ¥ ° 


"5 E o 




J 


o > *" 


o^ 1 " 


o > , " 


8 i^ 




s 

< 

CD 
O 

cc 


oi °° O 

** CO ^ 

II II 


s ^ <s 

o ^ o 

O CO 
CM* X CM* 
II II 


co^* 
00 * CO 

co K i> 

II II 


CO X 

CM SO CM 

7"* 




0. 




o 




5" 
o 






o 


o 


o 


u 






ST 


i 


CO 

sr 


CO 
OL 
















? 












> 








+ ^ 




E 






+ *•* 


o 










o 


/-*> ■*— ' 




o 






,-N **-• 


LT| 




pi 


/»-v 


»— V 


o 


. vO 




.—1 

• 


CO 


• vO U 

o oo o 


r^ CO 
co O 




< "5 


t— 4 


o 


m o 


v— ' • 




cc ® 


oo a 


vO S 


<s . S - 


SO 




. £ 


v-' p> 


x— * > 


vD^S 


vO ■*■«. S 




t * 


i 


s 


vO >-i > 


LO + U > 




Z w 


o \ 


O ^ 


lo + i>,a 


CM >>6 




iu A 


cm o 


CM O 


CM ^.-^ 


• ^-V 1 "^^. ^. 




QO 


o o 


o o 


• *"S O O 


•-I o o o 




• co 


CO 


HO uu 


w o o 




O fe 






^-^ CO cfl 


+ co CO 






+ CM 


+ vO 


+ 


o^ 




CM 


o 


CT> L/OCO 


H O00(M 




O <f 


o o 


r-H O ««3- 


vo cr> -<f 




•x 


co « 


CO 


V© CTn CM . 


CM • vO • 




CQ 


• CM 


. CM 


CM • \£>cO 


• co <r co 




E 






• CO 






II II 


II II 


II II II 


II II II 










•K 


* 




Ul 


"fr- 


> 


>■ 


>- 




H 












Z 












UJ 

2 

© 












ill 


o 

1 


SC 


M 




UJ 
CO 


CM 


1 

CM 


CM 


CM 






U 


J-l 










CJ 


0) 








-J 


4J 


4J 








UJ 

o 


d 




CO 


T-4 

CO 




o 


q) jj d 


d)4J C 


•rl 


•H 




2 


d co co 


Ceo co 


a u 


a j-i 




co-u ,Q 


cO+J ,a 


CO <U 


co <y 






JtO >J 


Jm u 


^3 4J 


rQ -W 






t> 


& 


J-i u 


}-l (-J 






<f s -' 


<f ^ 


13 <J 


£3 < 






















E 














a 














u 










«* 














c 




> 




• 






• 
"5 




c 
o 




E 






• 




"E 




"5 


a 




o 








£ 






>> 




«0 


•* 


e 


E 




s 




c 
• 


c 
® 


e 
o 


® 


© 


£ 0) 
Jo ,_l 




u 


u 


s 


£ 


jc 


O 'H 




o 


u 


E 


« 


«> 


S B 




c 


« 


> 


» 


o.-i^ 




II 


1! 


ll 


II 


II 


ii u 

11 cO 

cu 




>- 


o 

o 


E 

> 


E 


> 


8 s 


c 




« 


E 


s> 




s^^i 


9 












13 
•H 


-J 












8 



-195- 



Z 
O 

< 

u 



CQ 

< 
CQ 
O 
OS 
Cu 

Q 
< 

< 
OS 

Z 

u 

Q 
i— i 

U 

u 

< 

o 
U 

u 

X 
OS 

o 

EC 



r^ 



CM 



CO 

i » • 

5 5 °» 

S co « 

< Q D. 





E 


E 


E 


E 




E 




> "ff» 


> "C 


> "C 


> 


^^ 


> -c- 


>. 


E-i<? 


E-l* 


e£<? 


E 


-!<? 


? 2 


H 


75 E o 


7; E 


•5 E 


"0 


E 


j 


8 > *" 


> *" 


<&*" 





.i,*" 


8 ^ , " 


s 

< 

CD 
O 


oo r^ co 

Tf K lf 


•* ^ s 

1 tf 


cyi • C7\ 

^ N <t 


5 

CM 
CM 


00 ^ 

o> 


0? -5 


1 K 1i 


1 


"H 


1*f 


a 


5" 
o 





O 


5" 
O 


V 







o 





O 


O 















ST 




ST- 














.'_- pj 


? 














> 














E 




























o 


•— x 


^N 








/^■N 


■.I ° 


CO 


1— 1 


•~n. 


y~\ 




CO 


UJ CO 


• 


• 





1— 1 






1- *~ 


crJ 


CO 


• 


• 




m 


<"2 


o 


CN 


r^. 


<J\ 


* 


1— i 


k • 


1—1 P 


*~~* 


CM 6 


CM 





i-H fi 


Z CO 


N— ' 5 


W 8 
■—I ^ 


1— I > 


.—1 


5 


«*• > 


S 

CN *-~ 


^ < 


w 


^e 


S 


UJ JO 


■-I a 


T— 1 O 
O O 

CO 


^H O 


1— 1 





rH O 


go 


o o 

CO 


O CO 


t— 1 
O 




CO 


O O 

. CO 


ACC 
ted or 


+ oo 


m 

— 1 


r^. 


• 


O 


+ 00 




i-H 


+ 


CM 
CM 


O O 


<»■ 


00 • 


O 


O 


• 


00 


CO 


• i—i 


• CM 


CO CM 


co 


CM 


. CM 


E 

CO 

UJ 


II " 


II » 


if II 


II* 


II 


II II 


>■ 


>■ 


>- 


>- 




> 


H 














Z 














UJ 

2 
o 


< 


pq 


O 


O 




w 


m 


00 


CO 


1 

CO 




CO 


UJ 














(0 




} 




1 




! 




u 


U 


u 


u 




U 




<u . 


CD 


01 


CD 




0) 


—1 


CD 4J r-H CO 


4-1 


4-1 


■p 




4J 


UJ 

a 
O 


' Lane In 
state 

Urban) 


M CD c 
(U4-I CO 


014J 


C^ 


0)4_> CO 


s 


C CO CO ,Q 
CO 4-» J-j ^ 


CcO 43 

C04J U 


ficO 

C0 4J 


41 


CcS 43 

C04J M 




hJ CO 3 3 


hJ CO p 


i-J CO 


tD 


►Jco P 




C*3 43 


v— ' 




•^y 


v-^ 




vO V 


VO ^— ' 


vO 


vO 




vO 



• • 

2 S 

5 o 

o u 



II II 



> s 



E 

> f 

e • 

o o 

= JS 

E 5 

II It 



i f 

E > 



e 
• 
•a 
o 
o 



o 



• JB 

II 



II II 



-196- 



CO 

as 

O 

u 



CQ 

o 

as 
a* 

Q 

at 
< 

B 

«< 

E- 
& 

Q 

I— * 

U 
U 

< 

vo 

w 
w 

H 
CO 

CfiS 
O 



o-» 



> 



<N 



cn 



£ m 
2 5 • 

<OflL 



80 

< 
flB 
O 

AC 

a. 



E 

> 

E 



uS 



< 
cc 



« 
QO 



to 

UJ 



Ul 

S 
o 

Ul 

if) 



Ul 

Q 

o 



if* 

7; E o 

CO ^ 00 
00 o CT, 

II II 



O 

u 



o 

CM 

O 



O 
oo 



I 

CO 



4- 



(U4J 

c « 
cd-u 
►J to 



3 



if* 

o £,*^ 

S oo 5 

CM • O 

sr co cm 

u 

o 



E 
if* 

<S <r oS 
o < o 
o oo 



o 

a 



oo 



00 



o 

CM 
O 



O 
00 



II 

>- 



o 
I 

CO 



H 0I 


a 


CU-U 


.O 


S (4 


u 


Ctj4J 


ts 


t-3 w 


s^ 



CO 



o 

vO 



o 

CM 
O 



O 
CO 



II 

>- 



E 

If* 

II It 



u 



^4 O 



oo ,o 

+ *s 



oo 
oo 



X 

I 

CO 



I 

u 
<u 

4J 



Ctt*J 

hJ CO 



s 

,0 



CM 

I 
II 



CT> lOCO 

o ** 

<T\ CM 

• vocn 

CO 

II 



I 

CO 



c 

ct) 

,o 
u 

S3 



4) 

4J 

4 



I* 

E o 
£*" 

*■" K 

s£> CN 
l s 



1 

a 



• 

I-. vO . 
CO 00 w 

w ° 

• 

vO so B 
o oo 

+ v_/ o o 
ctjco 

f-l CT\ 

vO O00CN 

CM CT> •«* 

• »vD 

I co><rco 
II II 



II 

V 



*-3 
I 

CO 



> £ 
| 1 

i I • 



c 

.O 

u 



S-i 

o> 
J-l 

u 

< 



1 



5 - t E S 

• • e • • -g 

2 ^ o u o 2 

. 2 c • * I 

H H ii n n H 



> 2 I I > 1 
• E > * 



cd 

ai 

CO 

4-1 

C 
01 
nd 
•H 
O 

o 

ct) 
II 

>-• 



-197- 



o 

u 



< 

CO 
O 

£ 

Q 

6- 
< 

z 

w 

Q 

u 

H 
Cd 
(ad 

S 

* 
OS 
O 



S 



CM 



E , 

9 Si 9 

< o £ 



ID 
< 

a 
o 

s 
a. 



o 


•"N 


Ul8 


00 


*i 


ON 

o 

1— 1 


g! 


CM 


ut « 


•—I 


qo 


O 


S| 


+ 


«* 


m 


« 


<t 


• 




E 


|| 






iS 


>- 



Ul 

S 
o 

w 



Hi 

o 
o 



E 

If' 

IP 

MM 

vo r^ r>» 
if t 
f 

s 



< 
I 






I 

cd *2ct 



,5* 



ID • 00 
t-H CM CO 



Si 1 " 

£ u-> & 

CT> • CT> 
^ CM <t 



CO 
CM 



O 
00 



II 

>- 



PQ 
I 



CO 

«d 

4J 
CD CO 

cu 

COCO 

e 






CM 



O 
00 



II 

>• 



u 
o 
cd 



CM 
II 



C_> 
I 



cd 
cd <u 



c5oo >5 

CM • G\ 

I 



ON 
CM 



O 

+ 

o 

00 

H 

> 



Q 

I 

st 



CO 
*J 

cd 

CD CO 

cd co 
J S 

vO M 



i* 



! 



c* 4? 

• CM 

cm r»» 

"1 



vO 
O 



O 
00 



II 

> 



w 
I 



0) 

■p 
cd 

CO JJ 
C CO 

cd u 

hJ CO 
■M 
vO C 
fed. 




I 



8M»S 
• e •• £ 



-198- 



00 

as 

O 

B 
u 



CQ 

o 

Q 

5 



< 

as 

H 

as 

Ed 

B 

NO 

H 
W 
H 
E 
</) 

O 



CM 



CM 



m 

— co CO 
<Q0. 





E 


E 


E 


E 


E 




> f> 


> <c 


> «• 


> 'S' 


> ^ 




"?; E © 
a > ^ 


E|<? 
o > ^ 




E-§«? 






CD *-* X 


CB **■ X 


O^ CO 
co 1 ^ r> 


• sr * 


C '-' H 


s 


o «* «m 


O N ^ 


©*?, ON 


O VO CM 


< 

CD 


00 jrl 

m " oo 


£ cm" O 
00 ™ vO 


•tf™ 00 
CO 1^ 

II II 


<r vl oo 
cO oo 

II II 


o 

AC 


II II 


tf K 2 


tf B < 


0. 


o 


| " 
o 


f 


f 

5 


s 




CD 

0. 


0. 


3 


■ 

ST 


s 




/•N 


^^ 








j-. 


vD 


00 








E 


• 

CO 


1— I 




' 




> 
E 


+ ^ 


+^ 


+^ 


+^ 


+ ~ 






o 


o 


o 


IATE 
id (ace/ 


/-N vO 


^nvO 






/^v 


CO 00 


ON 00 


CM O 


o^o 


in 


. O CD 


• o <u 


•vO 


•VO 


•VO 


SO «iH 


CO • i-H 


vooo <u 


ooo <u 


r>.co 


m vo«h 

^ 


vOvO «H 


mo h 


u-)OiH, 
^x ••H 
vO 


CO o 
^^ • 


£ CO 
Z (ft 


+^ 1 

so H > 
m /^?*> 


+ **"•■ 


vO 


vO 


vO M > 
lOz-s P*. 


so — 5 


vO **^ > 
m+ u 


vo > 

m+ 


cm r^ - *^^. 


cMm*^. "v 


CM >» — 


CM >, — 


CM ^ 


UJ A 


. . o o 


• ♦ vuo 


«/-s CJ 


• /-s"^. CJ 


•/-N CJ 


QO 


h m cjjjcj 


Hifl ooo 


HO CJ CJ 


HO o o 


h O MCJ 




^cOOcO 


v- ' co cO 


w CJ cO 


v-x CJ CO 


^-y OCO 


s 


+ 


+ _ 


+ CO 


+ CO 


+ 


o^vo o 


OMO o 


on o 


ON O 


CT>«*0 


<? 


HO 'CO 


HO • CM 


ho coco 


HO"">CO 


<-l O00CM 


vo o>«<t m 


vOO\CM 00 


vOO\ .«* 


SOON •-» 


VOON «^ 


CB 


CM »<-H • 


CM • H • 


CM • O • 


CM .CM • 


CM «vO • 


. coin m 


• CO i-l ■>* 


• co r^co 


•COvOCO 


• CO^CO 


E 


1 II ll 


1 




1 


1 




11 " 


II II 


II 'I 


II 


1 


*JL >* 


II 


II 


II 


II 
* 




s* 


|H 


t» 


>^ 


>H 


H 






^ 






Z 












UJ 












S 


Pn 


O 


w 


M 


^ 


© 


1 


1 


1 


1 


1 


UJ 


«* 


<r 


sf 


•<r 


-Jf 


(0 










1 


-1 












UJ 












o 


iH 


H 


H 


iH 


fH 


o 


CO 


(3 cO 


C ctl 


CO 


CO 


C «H 


CO «H 


CO «H 


C -H 


•H 


s 


cO M 


& u 


.o M 


CO M 


C Vj 




j3 a) 


u <u 


u a) 


,0 <U 


co a) 




t-l 4-1 


!= 4J 


!=) 4J 


M 4J 


,Q 4J 




* Jo 


4 


4 


* 4 


& -5 



1 s 
i 1 



8 




— — — JS a a 



■ on 



> > 
u n 



! 



8| ? 

• E * 



8 
i 






-199- 



APPENDIX E 



WORKSHEETS 2 AND 3: 
CONSEQUENCES OF A FLAMMABLE LIQUID RELEASE 
ON THE FOUR ALTERNATIVE ROUTES 
IN THE WASHINGTON, D. C. CASE STUDY 



Alternative:. 



Date:. 



WORKSHEET 2: POPULATION INVENTORY 



PageJjrfJ. 



H.M. Clan; Flammable L iquid 
Impact BaiUm; -5 mile 

6 



SEGMENT 


CENSUS TRACTS 


SKCML 

POPULATIONS 


# 


0/0 


NUMBER 


1 

POPULATION > 


PERCENT OF TRACT . 
C IN IMPACT AREA 


_ POPULATION IN 
IMPACT AREA 


1-A 


From 1-395 
and 1-495 

To Tele- 
graph Rd. 

TOTAL 


4014 


3734 


.47 


1755 


8 schools 


4036 


3396 


.10 


340 


4015 


2689 


.81 


2178 


4016 


4941 


.73 


3607 


4017 


4274 


.13 


556 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


8436 


1-B 


To Rte. 1 


4018 


4127 


.28 


1156 


3 schools 


4019 


5559 


.79 


4392 


2007 


1749 


.22 


385 


2Q2Q n Q2, 


3115 


.88 


2741 


2017 


1292 


.11 


142 


4002 


4622 


.05 


231 


TOTAL 


XXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


9047 


L-C 


To: Indian 
Head Hwy. 


8014.03 


2944 


.20 


589 


1 school 


8014.04 


3102 


.14 


434 


TOTAL 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


1023 


L-D 




8014.05 


5139 


.49 


2518 


6 schools 


8015 


3585 


.36 


1291 


8017.03 


10289 


.59 


6071 


8014.02 


3748 


.05 


187 


8017.02 


2784 


.93 


2589 


8017.01 


5976 


.05 


299 


8017.05 


3742 


.05 


187 


8019.02 


630 


.17 


107- 



-200- 



Alternative . 



Date. 



WORKSHEET t POPULATION INVENTORY 



H.M. Class: Flammable L iquid 



Pim.2jf.2_ 



Impact »»iuw .5 mile 

6 



SCSMOIT 


corns men 


SKOAL 

popuunow 


# 


0/0 


HOMO 


roruuruw < 


me»T»TMci . 

• IK IMPACT JUU f 


rarounoN in 

WMCT «U 


1-D 
(co 


at'd) 

To 
Pennsylva- 
nia Avenue 


8,019.01 


6,453 


.33 


2,129 




8,019.03 


7,089 


.43 


3,048 


8,019.04 


4,116 


.44 


1,811 


8.011.02 


6.418 


.07 


449 


8,021.01 


5,155 


.27 


1,392 


TOTAL 


XXXXXXXX 


XXXXXXXXXX 


XXXXXXXXXXX 


22,078 


1-E 


To: 1-495 
and Rte. 
50 


8.022.02 


9,789 


.19 


1,860 


4 schools 


8,022.01 


669 


.43 


288 


es: 


•IMATED AREA 




12,092 


8,028.02 


7,291 


.12 


875 


8,035.02 


1,653 


.24 


397 


8,035.03 


7,735 


.26 


2,011 


8,036.02 


4,487 


.31 


1,391 


8,036.01 


2,493 


.44 


1,097 


8,036.08 


5,597 


.05 


280 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXXXX 


20,291 






































































- 



-201- 



Alternative. 
Date 



WORKSHEET 3: PROPERTY INVENTORY 



Page_iof_I_ 



H.M. d an ; Flammable Li quid 
Impact Radius .5 mile 



SEGMENT 


LAND USE (mils hwtiitt rojtfmjl 


NUMBER OF ROADWAY 
STRUCTURES 


SPECIAL 
PROPERTIES 


# 


O/O 


Hi-oENsrn 

RESID. 


MO-QENSITY 
RESIO. 


10W-0ENSITY 
RESia 


PUBLIC 


COMMERCIAL 


INDUSTRIAL 


BRIDGE 


OVERPASS 


1-A 






2.1 


1.7 




0.5(0.4) 


2.1 


(3) 


1 




1-B 




0.1 


0.8 






0.3(0.1) 


0.7(0.2) 


(1) 


(2) 


Sewage 

Treatment 

Plant 


1-C 






0.8(0.2) 






0.2(0.1) 




(1) 


(3) 


Woodrow 

Wilson 

Bridge 


1-D 




(0.1) 


4.5 


6.4(0.3) 


1.5(1.0) 


0.2(0.1) 




(2) 


(1) 




1-E 






5.0 


2.3 






2.0 


(2) 


(5) 



















































































































Note: Values in parentheses are observations made during a "drive-by" inspection 
and represent our best judgement as to the land-use type. The other cell 
entries were developed from land-use maps. 



-202- 



Alttrnathra: . 



Date. 



WORKSHEET 2: POPULATION INVENTORY 



H.M. C | n r^l annna t)le Li quid 



PapJjfJ. 



Impact fariiiif .5 mile 
6 



SEGMENT 


CENSUS TRACTS 


SPECIAL 
POPULATIONS 


# 


0/0 


NUMBER 


POPULATION 


PERCENT Of TRACT . 
( IN IMPACT AREA 


POPULATION IN 
IMPACT AREA 


>-A 


From 1-395 
and 1-495 

To: 
Telegraph 
Road 


4,014 


3,734 


.47 


1,755 


8 schools 


d.mfi 


7,?Q6 


in 


■KUO 


4,015 


2,689 


.81 


2,178 


4,016 


4,941 


.73 


3,607 


4,017 


4,274 


.13 


556 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXX 


8,436 


»-B 


To: Rte 1 


4,018 


4,127 


.28 


1,156 


3 schools 


4,019 


5,559 


.79 


4,392 


2,007 


1,749 


.22 


385 


2,020.02 


3,115 


.88 


2,741 


2,017 


1,292 


.11 


142 


4,002 


4,622 


.05 


231 


TOTAL 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXXXX 


9,047 


!-C 


To: Indian 
Head Hwy. 


8.014.03 


2,944 - 


.20 


589 


1 school 


^ 8,014.04 


3,102 


.14 


434 


TOTAL 


XXXXXXX 


XXXXXXXX 


XXXXXXXXXX 


1,023 


!-D 


To: 1-295 
& Portland 
Street 


73.08 


1.153 


.61 


7m 




, 7^,07 


8.211 


.17 


l.lQfi 


73.01 


5,211 


.67 


3,491 


TOTAL 


XXXXXXXX 


XXXXXXXXX 


XXXXXXXXX 


5,590 


»-E 


To: Suit- 
land Park- 
way 


73.01 


5,211 


.28 


1,459 


2 schools 


73.02 


5,751 


.05 


289 


96 


4.341 


.17 


738 


74,02 


12.789 


.05 


639 - 



-203- 



Alternative . 
Date: 



WORKSHEET 2: POPULATION INVENTORY 



H.M. fla n ; Flammable L iquid 



Pan? 


rf2 


2 


3 


4 


5 


impact Radius: .5 mile 

6 






1 




SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 




# 


0/0 


NUMBER 


1 
POPULATION ; 


PERCENT OF TRACT . 
< IN IMPACT AREA 


. POPULATION IN 
IMPACT AREA 




2-E 
:ont 




74.01 


4.538 


.84 


3.812 


4 schools 

V 


( 


'd) 
TOTAL 


XXXXXXXX 


XXXXXXXX 


XXXXXXXXX 


6,937 




2-F 


To: Minne- 
sota Ave. 


75.01 


7,953 


.38 


3,022 




76.01 


7 17? 


.95 


6,766 




76.02 


8,673 


.05 


434 




77.01 


6,514 


1.00 


6,514 




68.03 


1,471 


.05 


74 




77.02 


7,182 


.49 


3,519 




78.02 


7,786 


.95 


7,397 




TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXX 


27,726 


: 


2-G 


ro:B-W 
Parkway 


78.01 


7.745 


.36 


2.788 


4 schools 




TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXX 


2,788 




2-H 


To : Land- 
over Ave. 


8,043 


4,319 


.75 


3,239 


1 school 




8,042 


4,777 


.71 


3,392 




8,041.01 


2,083 


.78 


1,635 




8,032 


3,496 


.41 


1,433 




TOTAL 


XXXXXXXX 


XXXXXXXXX 


XXXXXXXXX 


9,699 




-I 


To: 1-495 
md Rte 50 


8,041.02 


5,597 


.35 


1.959 


2 schools 


« 


8,035.03 


7,735 


.17 


1,315 




8,037 


3,831 


.53 


2,030 




8,036.02 


4,487 


.50 


2,244 




8,036.03 


10,406 


.22 


2,289 




TOTAL 


XXXXXXXX 


XXXXXXXX 


XXXXXXXXXX 


9,837 

















-204- 



tUimtim- I 



Date. 



WORKSHEET 3: PROPERTY INVEHTORY 



P«I«_io<_L. 



H.M. n^ n-Flammable Liq uid 
Impact Radius - 5 mile 





























SB 


.MOT 


UMO US (ate fnrttag nMm) 


NUMBER OF MUMMY 
STRUCTURES 


SPECIAL 
PROPERTIES 




* 


O/O 


M-OFJKITT 

mo. 


mo-knsitt 

RISIO. 


imwcNsm 
ttsia 


rustic 


CUIMEKUL 


INDUSTKML 


MIME 


wares 




2-A 






2.1 


1.7 




0.5(0.4) 


2.1 


3 


1 






2-B 




0.1 


0.8 




(0.1) 


0.3(0.1) 


0.7(0.2 


1 


2 


Sewage 

Treatment 

Plant 




2-C 








0.8(0.2) 




0.2(0.1) 




1 


3 


Woodrow 

Wilson 

Bridge 




2-D 




0.5(0.5) 


0.7(0.5) 








1.0(1.0 


1 





Sewage 

Treatment 

Plant 




2-E 








0.4(0.3) 


0.2 




L.0(0.5) 


2 









2-F 






0.2(0.2) 


1.0(0.6) 


0.2 




3.5(0.2) 


2 


3 






2-G 








0.5(0.2) 






0.1 


1 


1 






2-H 








0.5(0.2) 




. 


3.7(0.4) 





4 






2-1 






0.4(0.2) 


0.4(0.3) 




0.5 


3.8(0.2) 


2 


1 













































































Note: Values in parenthesis are observations made during a "drive-by" inspection 
and represent pur best judgement as to the land-use type. The other cell 
entries were developed from land-use maps. 



-205- 



Altff IMtiVK . 



Date. 



WORKSHEET 2: POPULATION INVENTORY 



HJL (^ Flammable L iquid 



Pagejj*— 3 - 



Impact Badim: .5 mil e 

6 



SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 


# 


O/O 


mum 


population 


PERCENT Of TRACT . 
( IN IMPACT AREA 


_ POPULATION IN 
IMPACT AREA 


3-A 


From 1-4^5 
and 1-395 

To: Duke 
Street 


4.035 


6.511 


.36 


2,344 


\J 


4,036 


3,396 


.58 


1,970 


4,055 


3,314 


.04 


133 


2,004 


4,204 


.13 


547 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXX 


4,994 


3-B 


To: King 
Street 


2,001.03 


5,723 


.51 


2,919 




2,003.03 


1,482 


.62 


919 


2,001.04 


3,180 


.91 


2,894 


2,003.01 


2,944 


1.00 


2,944 


2,003.02 


5,910 


.32 


1,891 


2,001.05 


2,146 


.08 


172 


2.002 


2.608 


1.00 


2.608 


2,001.01 


4,360 


.28 


1,221 


2,001.01 


2,826 


.37 


1,046 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXX 


16,614 




To: 

Washing- 
ton Blvd. 


1,029 


6,599 


.55 


3,629 




1,030 


4,137 


.67 


2,772 


2,010 


3,497 


.68 


2,378 


2,011 


6,441 


.05 


322 


1,038 


3.716 


.64 


2,378 


1 ? 031 


4,691 


.32 


1,501 


1,037 


2,955 


.33 


975 


1,032 


6,696 


.47 


3,147 


1,033 


1,046 


.95 


994 - 



-206- 



Alternative: . 
Date 



WORKSHEET £ POPULATION INVENTORY 



Pagi_2flf_L 



H.M. Oat Flammable L iquid 
Impact a**.- - 5 mlle 







1 


2 


3 


4 


5 


6 




SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 




# 


0(D 


NUMBER 


raniumoN 


PERCENT Of TRACT . 
( IN IMPACT AREA 


POPUUTKW IN 
IMPACT ARE* 


( 


l-C 
:ont 

J-D 


•d) 

TOTAL 
To: 14th 
Street 
Bridge 


103 


4,872 


.05 


244 






xxxxxxxx 


XXXXXXXXX 


XXXXXXXXXXXX 


18,340 




1,035 


4,181 


.49 


2,049 






1,034 


5,814 


.22 


1,279 




TOTAL 


XXXXXXXXX 


XXXXXXXXXX 


XXXXXXXXXXX 


3,328 




3-f 


To: 
11th 
Street 
Bridge 


62 


495 


.56 


277 






61 


1,112 


.83 


923 




60.01 


4,056 


.59 


2,393 




60.02 


922 


1.00 


922 




65 


3,689 


.70 


2,582 




70 


3,133 


1.00 


3,133 




72 


4,290 


.73 


3,132 




71 


4,264 


.80 


3,411 




TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXXXX 


16,773 




3-F 


To: 

Sultland 
Parkway 


74.01 


4,538 


.53 


2,405 






75.01 


7,953 


.30 


2,386 




TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXX 


4,791 




3-G 


To: 

Minnesota 

Ave. 


75.01 


7,953 


.38 


3,022 






76.01 


7,122 


.95 


6,766 




76.02 


8,673 


.05 


434 




77.01 


6,514 


1.00 


6,514 




68.03 


1,471 


.05 


74 




77.02 


7,182 


.49 


3,519 




78.02 


7,786 


.95 


7,397 " 



-207- 



Date. 



WORKSHEET t POPULATION INVENTORY 



H.M. tt—fFlamroable Li quid 



PHaJjfJL 



Impact Bartiii*- . 5 mile 

6 



SEGMENT 


eaSUS TRACTS 


SPECIAL 
POPULATIONS 


# 


0(0 


homer 


1 
population ; 


percent or tract . 

C IN IHPMT AREA 


. POPULATION IN 
IMPACT AREA 


i-G 

(cor 


t*d) TOTAL 


xxxxxxxxx 


XXXXXXXXXX 


xxxxxxxxxxxxx 


27,726 




3-H 


To:B-W Pwa: 
& Rte 50 


1 

78.01 


7.745 i 


.36 


2,788 




TOTAL 


XXXXXXXXX 


XXXXXXXXXX 


xxxxxxxxxxxx 


2,788 


3-1 


To: 
Landover 
Avenue 


8,043 


4,319 


.75 


3,239 


V 


8,042 


4,777 


.71 


3,392 


8.041.01 


2,083 


.78 


1,625 


u 8,032 


3,496 


.41 


1,433 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


xxxxxxxxxxx 


9,689 


3-J 


To: 
1-495 & 
Rte. 50 


8,041 


5,597 


.35 


1,959 




8,035.03 


7,735 


.17 


1,315 


8,037 


3,831 


.53 


2,030 


fi. 0,36,02. 


4.487 


.50 


2.244 


8.036.03 


10,406 


.22 


2,289 


TOTAL 


XXXXXXXXXX 


XXXXXXXXXX 


xxxxxxxxxxx 


9,837 






















































































- 



-208- 



Alternative:. 
Data 



WORKSHEET 3: PROPERTY INVENTORY 



Page_Lofl_ 



H.M. dan : Flammable Liq uid 
Impact Radius - 5 mile 



SE6UENT 


UNO USE (mHa fratini nadmjl 


NUMBER OF ROADWAY 
STRUCTURES 


SPECIAL 
PROPERTIES 


# 


O/o 


HI-OENSITT 
RESIO. 


MD4ENSITT 

RESIO. 


lOW-OENSITT 
RESIO. 


PUBUC 


COMMERCIAL 


INDUSTRIAL 


BRIDCE 


OVERPASS 


3-A 




.2(0.4) 


1 (0.3) 


.3 




.5(1.1) 


2(0.3) 


(3) 


(4) 




3-B 




.3(0.3) 


2.0(0.4) 


(0.7) 


.2 


.8(0.3) 




(2) 


(6) 




3-C 




(0.3) 


1.0 


1.2(0.4) 


1.0 


.5 


(0.2) 


(2) 


(6) 




3-D 




(0.6) 






2.0 


1.2(0.4) 




(10) 


(1) 




3-E 






1.0(0.3) 


(0.3) 




(0.4) 


(0.2) 


(3) 


(10) 




3-F 






.5(0.2) 


(0.1) 


.5 






(1) 


(1) 




3-G 






2.0(0.2) 


(0.6) 


.4 




(0.2) 


(2) 


(3) 




3-H 




(0.1) 


(0.1) 


1.5 


.3 






(1) 


(1) 




3-1 




1.0 




(0.2) 




1.0 


(0.4) 




(4) 




3-J 




1.0 


(0.2) 


(0.3) 




1.0 


(0.2) 


(2) 


(1) 





























































































Note: Values in parentheses are observations made during a "drive-by' 

inspection and represent our best judgement as to the land-use type. 
The other cell entries were developed from land-use maps. 



-209- 



Alternative . 
Date. 



WORKSHEET 2: POPULATION INVENTORY 



Pagiiof. 



H.M. OattElfflmahlS Liquid 
Impact BarfiiM: .5 mile 

6 



SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 


# 


O/O 


NUMBER 


population > 


PERCENT OF TRACT . 
' IN IMPACT AREA 


POPULATION IN 
IMPACT AREA 


4-A 


From 1-495 
& 1-395 

To : Duke 
Street 


4,035 


6,511 


.36 


2,344 


'V 


4,036 


3,396 


.58 


1,970 


4,055 


3,314 


.04 


133 


2,004 


4,204 


.13 


547 


TOTAL 


XXXXXXXXX 


XXXXXXXXXX 


xxxxxxxxxxx 


4,994 


4-B 


To: 
King St. 


2,001.03 


5,723 


.51 


2,919 


- 


2,003.03 


1,482 


.62 


919 


2,001.04 


3,180 


.91 


2,894 


2,003.01 


2,944 


1.00 


2,944 


2,003.02 


5,910 


.32 


1,891 


2,001.05 


2,146 


.08 


172 


2,002 


2,608 


1.00 


2,608 


2,001.01 


4,360 


.28 


1,221 


2,001.01 


2,826 


.37 


1,046 


TOTAL 


XXXXXXXX 


CXXXXXXXXXXX 


XXXXXXXXXXXX 


16,614 


i-C 


To: 
Washington 
Blvd. 


1,029 


6,599 


.55 


3,629 




1,030 


4,137 


.67 


2,772 


2,010 


3,497 


.68 


2,378 


2,011 


6,441 


.05 


322 


1,038 


3,716 


.64 


2,378 


1,031 


4,691 


.32 


1,501 


1,037 


2,955 


.33 


975 


1,032 


6,696 


.47 


3,147 


1,033 


1,046 


.95 


994" 



-210- 



Altamatiw: . 
Date 



WORKSHEET 2: POPULATION INVENTORY 



Pag«2j>f_3_ 



H.M. r-liwg Flammable L iquid 
Impact R««i«. -5 mile 





1 


2 


3 


4 


5 


6 


SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 


# 


O/O 


NUMBER 


POPULATION ; 


PERCENT OF TRACT . 
< IK IMPACT AREA 


POPULATION IN 
IMPACT AREA 


4-C 
(coi 


it'd) 

TOTAL 


1,036 


4,872 


.05 


244 




XXXXXXXXX 


XXXXXXXXXXX* 


xxxxxxxxxxx 


L8.340 


4-D 


To: 
14th St. 
Bridge 


1,035 


4,181 


.49 


2,049 




1,034 


5,814 


.22 


1,279 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXX 


3,328 


4-E 

1 


To : New 
Jersey Ave. 
. Rte. 50 


62 


495 


.52 


257 




61 


1,112 


1.00 


1,112 


6Q.01 


4.056 


1.00 


4,056 


60.02 


922 


.75 


692 


59 


1,638 


1.00 


1,638 


58 


1,192 


.27 


322 


47 


3,701 


1.00 


3,701 


48.02 


2,864 


1.00 


2,864 


49.02 


2,527 


.05 


126 


48.01 


3,661 


.27 


988 


46 


5,830 


.71 


4,139 


TOTAL 


XXXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXX 


19,895 


4-F 


To: 
Brentwood 
Parkway 


86 


547 


.54 


295 




87 


7,585 


.60 


4,551 


91.02 


6,403 


.65 


4,162 


88.01 


7,224 


.86 


6,213 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXX 


15,221 






91.01 


4,967 


.12 


596 




90 


1,909 


.58 


1,107 



-211- 



Alternative. 



Date:. 



WORKSHEET 2: POPULATION INVENTORY 



PagaJofJ. 



H.M. date Flammable L iquid 
Impact n.awr -5 mile 





1 


2 


3 


4 


s 


6 


SEGMENT 


CENSUS TRACTS 


SPECIAL 

POPULATIONS 


# 


OfO 


NUMBER 


rarauTiON 


PERCENT Of TRACT . 
IN IMPACT AREA 


population in 
impact area 


4-G 


To : South 

Dakota 

Ave. 


89.01 


4,621 


.41 


1,895 




78.01 


7,745 


.22 


1,704 


TOTAL 


XXXXXXXXX 


XXXXXXXX 


XXXXXXXXXXX 


15,677 


4-B 


To:B-W 
Parkwav 


8,042 


4.319 


.25 


1,080 


"\J 


TOTAL 


xxxxxxxxxx 


XXXXXXXXX 


XXXXXXXXXXXX 


1,080 


4-1 


To: 
Landover 
Ave. 


8,043 


4,319 


.75 


3,239 




8,042 


4,777 


.71 


3,392 


8,041.01 


2,083 


.78 


1,625 


8,032 


3,496 


.41 


1,433 


TOTAL 


XXXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXX 


9,689 


l-J 


To: 
1-495 & 
Rte. 50 


8,041.02 


5,597 


.35 


1,959 




8,035.03 


7,735 


.17 


1,315 


8,037 


3,831 


.53 


2,030 


8,036.02 


4,487 


.50 


2,244 


8,036.03 


10,406 


.22 


2,289 


TOTAL 


XXXXXXXX 


XXXXXXXXX 


XXXXXXXXXXXXX 


9,837 









































































-212- 



Alternative. 
Date: 



WORKSHEET 3: PROPERTY INVENTORY 



Pag»i_o»_±_ 



HM Class: Flammable Liquid 
Impact Radius ' 5 mile 



SEC 


MM 


LAND USE (mfla Irootint rosdssrl 


NUMBER Of ROADWAY 
STRUCTURES 


SPECIAL 
PROPERTIES 


# 


OIO 


HMEHSOT 
RtSID. 


MlWiNSITY 

RESIO. 


lqw-oensitt 
RESIO. 


PUBLIC 


COMMERCIAL 


INDUSTRIAL 


BRIDGE 


OVERPASS 


4-A 




.2 (0.4) 


1 (0.3) 


.3 




.5(1.1) 


2 (0.3) 


(3) 


(4) 




4-B 




.3 (0.3) 


2.0 (0.4) 


(0.7) 


.2 


.8 (0.3) 


(2) 


(6) 




4-C 




(0.3) 


1.0 


1.2 (0.4) 


1.0 


.5 


(0.2) 


(2) 


(6) 




4-D 




(0.6) 






2.0 


1.2(0.4] 




(10) 


(1) 


Pentagon 


4-E 




(.2) 


.4 (.1) 




1.0 (.4) 


.5 (.3) 




(2) 


(12) 




4-F 






.8 (.4) 


(.2) 






1.0(.6) 


(0) 


(0) 




4-G 






(.2) 




.5 (.2) 




2.0(1.5) 


(2) 


(2) 




4-H 




(.1) 




(.4) 


•5 (.2) 






(2) 


(1) 




4-1 




1.0 




(0.2) 




1.0 


(0.4) 




(4) 




4-J 




1.0 


(0.2) 


(0.3) 




L.O 


(0.2) 


(2) 


(1) 






































































M„<-„ 




1 



















represent our best judgement as to the land-use type. The other cell entries 
were developed from land-use maps. 



-213- 



APPENDIX F 



CONTROL MEDIUMS FOR SELECTED 
HAZARDOUS MATERIALS FIRES 



CO 


4c 


CO Eh 


5-1 5-1 


w z 

H W 


Eh Q 


H H 
Q U 


J fa 


O U 


4e 


i < 


H 


o z 


(0 5-1 


U H 


J Q 


CO fa 


O W 




« > 




. Eh J 




m 2p 




O > 
w U Z 




^ H 




$ o 




H Eh>h 
Q Eh 




W Z 


*d 

Q 


CO w 


D D 


a 


5 


£ W 




u 


D « 


H fa 


Q 




W Eh 




S CO 




O 




g 





H >t rH 



c. 
d) 

rH 
>i 
•P 

<D 
O 
< 



0) 

c 

rH 

JBf 

W 



CO 

d 



in 





»d 


o 






•H 




O 




D 


6 


c 


(0 


CT 


3 


•H 


rd 


•H 


0) 


g 


rj 


J 


rH 


rd 









H 


c 


C 


S-l 


>1 


V 


0) 


4J 


43 


& 


u\ 


0) 


■P 





o 


P* 


<U 


H 


u 




g 


•0 


«d 


D 1 


•H 


>i 


>i 


•H 


5-1 


K 


s 


r-H* 


Eh 



•d 

I 



0) 
0) 
5-1 

Eh U 
<D 

D*rH 
grH 
O -H 

U « 



d) 

•d 

•H 

fi 
rd 
>i 

u 

g 

3 
•H 

•d 
o 

CO 



-214- 



CO 



CO 



m 



in 



10 



m m 



in 



m 



m 



m 



m 



in in 























O 1 
































•H 
































h! 




























•0 










• 












43 


cr 






•0 


•H 




Q 






CO 












*> 


•H 






•H 







»0 




^ 


• 






en 






& 


Hi 






3 


< 




•H 







o 






• 










D» 




iH 






X 


13 


id 


t 






o 






M 


id 


c 




fa 


u 







•H 


J2 


2 






■ 









*a 


•H 






•H 


>o 


u 


O 


4J 








2 


•P 




•P 





C 




•M 


M 


•H 


U 


< 


3 


tr 








CO CO 


CO 


CO 


cd 


9 


•P 








>i 




U 


•H 






cr 


3 


• 






Q) 


> 


« 


iH 


< 


s 







A 


H 


a 


•H 


to O 


>i 





rH 


•H 


(B 


jC 






•H 


4J 




•H 


c 


•J 


u 


• 


U 


•H 


u 


to 




U 





g 


M 


rH 


CO 


o 









s 





+» 


U 


CO 


+» 





•H 


9 


9 


id 


3 




10 


•o 


id 




*J 


(0 


Q> 


u • 


O 


M 


M 


•H 


<h 


.e 


1 


iH 





•H 


^ 


tj 1 


+J 


3 


g cr 


MO 


<U 


*a 


*> 


•O 


iH 


a 





u 





iH 


•H 


(0 


(d 


0«H 


• 


rH 


>i 


•H 





3 


CO 





3 


a> 


< 


< Hi 


CQ 


u 


UhI 


U 2 


w 


a 


Z 


CO 


CO 


< 


CJ 


fa 


* 



CN 



vo 



V0 



V0 



10 



vo 



VO 



vo 



in 



CM 



in 



m 



in 



in 



vo 



vo vo 



vo 



vo 



vo 



vo 



O 

CO 



O 

c 
(1) 
.c 

Ou 

o 

o 

c 

•H 

a 







«D 






+* 


>1 




id 


H 


a> 


jfi 


Q 


•0 


Ou 




•h 


(0 


<D 


g 





13 





A 


•H 13 


u 


fa 


O'H 


cq 




•H 3 







4J cr 


rH 


•H 


0*H 


>i 


C 


a h! 


A 


id 


to 


j-> 


0* 


C M 


0) 


M 


H 


S 


O 



•H 
3 
O 1 
•H 
i-J 

CQ 

3 
O 

c 
o 

CO 

•H 

o 

fa 



c 
o 

♦H 

•p 

3 
H 
O 
CO 

CO 

3 
O 

c 
o 

CO 

•H 


fa 



CO 



rH Z 



o 












o 


CO 










o 


0) 




< 


a 


u 


fe 


> 










H 


'H 




CO 


CO 


to 




CO 


,Q 


CO 


CO 


CO 


CO 





g 


id 


id 


id 


Ou 


rH 





rH 


rH 


rH 


id 


a 


a 


U 


U 


u 


u 


X 












fa 


a) 


<D 


Q) 


0) 


c^ 




> 


> 


> 


> 


c 


u 


•H 


•H 


•H 


*H 


•H 


a) 


CO 


CO 


10 


CO 


P 


•P 














CO 


co 


rH 


rH 


rH 


rH 


id 


o 


04 


Ou 


a 


a 


rH 


o 


X 


X 


X 


X 


CQ 





fa 


fa 


u 


w 



-215- 



m in m in 



in in 



m 



m m 



m 



m 



m 



• 


A 


h3 




CO 


u 


O 




o 


«H 


• 




• 


rH 


CO 




z 


•H 


• 






4J 


o 




H 


(0 


• 







•H 


z 




u 


Q 






4J 




4J 


o 


<D 


iH 


G 


c 


Pk 





<D 


o 




H 


> 


4J 


rH 


4J 


rH 


<u 


•H 


0) 





o 


O 


0< 


CO 


< 







M 




• 


a) 




CO 


> 




• 





• 


o 


g 


CO 


• 


0) 


• 


z 


os 


o 






• 


cr 


•p 


z 


•H 


c 




^ 


•H 


iH 




id 





4J 


fa 


JC 


G 







SJ 


a 





6 


E 


H 


0) 


O 


< 


o 


u 



o 

u 

V 

04 



0) 



H 

u 





C 








k 




JQ 








en 




M 




• 




id 




3 




CO 




^ 


• 


E* 




• 






CO 






o 




k 


• 


C 




• 




H 


o 







z 




0) 


• 


♦H 








E 


z 


•M 




H 


• 


id 




id 




o 


CO 


c 


O 1 


•H 


a) 


3 


• 


a) 


•H 


> 


c 


«H 


o 




h3 


< 


•H 




• 


w 






*H 


H 


z 


•P c 


6 


•H 


o^ 







G-H 


«0 


0) 


n 


•p 


H 


•h id 


H 


9 


id 


o 


•H 


id +j 


fa 


fa 


O 


s 


O 


fa CO 



CO 



Z 



z 






at 



o\ 



in 



m m in m 



m 



z 



z 



G 
D 



•H 
H 
O 
CO 

a> 

rH 

.a 
id 



CO 



id o 

rH • 
fa Z 



3 
CO 

id 
•P 

G 
O 
fa 

CO 

O 

w 
o 

x: 
a. 
w 
o 

fa 



H 

•a 

§ 

fa 

CO 

w 
o 

rH 
0) 

a; 



CO 



ft 

-P 
•H 
IH 
H 
9 
C4 
O 
H 
•O 
>i 

s 



•H 

•a 
o 

CO 



•P 

H 

a) 
fa 



•H 

s 

o 

p 

•H 

W 

o 

iH 

JS 
O 
O 

04 



id 
u 



•h 
u 

u 

•H 

I 

U 
JS 
CJ 



0i 










•P 










id 










H 








• 


P 




D 1 




CO 


•H 




•H 




• 


z 


CO 


»-3 


•0 


o 


1 


• 




a 


• 





o 


CO 


•H 


z 


.Q 


• 


(0 


IH 


' 


W 


z 


a 


•H 


(0 


id 




H 


3 


CO 


U 


+» 


fa 


CT 


id 




id 




•H 


O 


O 


s 


G 


J 




W 




O 




& 


P 


>1 


t* 


IN 


S 


•H 


X 


H 


O 





Z 


o 


< 


U 


u 



-216- 



w 

w 
u 

PS 

D 

o 

en 



en 

oi<n 

c 

0) 






01 



co 

H 
«J 

•H 
U 
<D 

•P 

cd 

S 

CO 



5-1 
fd 
N 
(d 

E 



-p 

0) 
CO 



o 



c 
o 

-P 

0> 

fl 
•H 

CO 

fd 



p » 

•H P 

to <w 
M (0 



CD 
> 

C 
D 



5-i 
Q 





d) 


CO 1 


c 


•H 


•H 


D 


M U 


04 







V 


s 


CO 




C 


to 


o 


c 


o. 


.c 


CO 





0) 


1^3 « 
















P 






















5-i 






















•H 






















13 






















5-1 













































iH 






















fd 






g 























rd 














e 


•H 






O 














to 


£ 






<w 




















.c 








CN 










«w 




<o 








O 

u 










* 


a 






fd 


0) 












>1 


>i-H 


flj 




5-1 


g 


rH 










<d 


5-1 fd 


-a 




a 


•H 


id 










5-1 


T3 CT> 


o 




CO 


rH 


o 










a 


(0 


CO 








•H 










CO 


0) 






o 


W 


g 


g 










W P 


5-1 


g 


m-CN 


.C 


<U 


fd 








o 


D 5-1 





d 


«■*« 


OT 


A 











CN 


(0 









<d 


O 


(H 








B 


5-1 P 
W 


iH 
(0 


<u 


'O 


fd 


>i 


5-1 








* 




U 


^ 


£ 


13 


5-1 







5-1 


<N 


CN 


5-1 >i 


•H 


<N 


fd 





-a 






0) 


O 


O 


<D A3 


g 


o 


w 


CO 




tn 




P 


U 


u 


■M g 


a 


u 






* 







ia 


\ 


\ 


03 


^ 




^ 


■fc 


P 


«M 




5 


rH 


rH 


5 a 





r-i 


rH 


rH 


CJ 








fd 


fd 


5-1 




(0 


fd 


fd 


^ 


^ 




jC 





O 


J3 -H 


>i 


o 


u 





c 


>i 


>i 


4J 


•H 


•H 


P iw 


5-1 


•H 


•H 


•H 


fd 


<d 


fd 


•H 


E 


£ 


•H 


-a 


g 


g 


g 


rH 


u 


5-1 


5 


a 


05 


S fi 




0) 


0) 


0) 


ja 


04 


04 




JS 


JC 





* 


43 


.C 


£ 




CO 


CO 


•0 









T3 -H 
P 


5-1 


O 


o 


u 


5-1 
0) 


o 


O 





>1 


>i 


3 


P 


>i 


>1 


>1 


p 


CN 


OJ 


rH 


5-1 


5-1 


H fd 


fd 


S-l 


5-1 


5-1 


fd 


fr* 


X 


b 


Q 


a 


fa U 


S 


Q 


a 


a 


[2 


II 


II 


II 


II 


ii 


II 


II 


II 


ii 


ii 


11 


rH 


<N 


n 


■o« 


in 


vo 


r^ 


CO 


<j> 


o 

rH 


rH 
rH 



-217- 



CM 

CO 

w 
53 



r» 

\ 
o\ 

W 
Q 
H 

D 
O 

w 
w 

W 2 
W O 
H ft 



H 

Q 

O 



U 
O 2 
U W 

u 
w w 

O 2 



as 

Eh 

O 
« 
Eh 

o 
u 

o 

Eh 

Q 

W 

en 
D 

2 
D 

H 
Q 
fa 
2 



* 

Q) 

tn <d 
u u 

H^ fa 



(0 H 
S-H 
W fa 



>i 
•P 
•H 
•O 

O 



o 
u 



in 



in 



in 



in 

















Qi 
















<a 
















•H 






(0 






0) 




4-4 






■H 






•0 




H 






c 






•H 




3 






o 






U 




w 




a) 


£ 











•H 




+> 


£ 




<*P 


3 




Q 




•H 


>5 




O 


H 








u 






^ 


4-4 




D 1 




■p 


(0 






•H 




•H 


c 


•H 


p 




U 


M 




(-h" 


•H 


c 





<d 


0) 


Eh 


<D 




0) 





u 


•H 


> 




c 


C 


H 


H 


T3 


c 





G 


•H 


O 





>1 


>i 







O 


e 


.Q 


H 


M 


,C 


£ 


fH 


U 


o 


U 





o 


£ 


g 





O 


M 


(C 


< 


< 


< 


w 


CQ 


« 


U 



-218- 



■HH^^H^BM 



■— 



C 
D 



C 
D 



m 



•H 

P 

tr 

•H 

c 

•H 

M 

O 

D 
rH 
fa 





0) 






T3 


<D 




•H 


^ 




M 


•H 


0) 





'4-1 


c 


rH 


rH 


•H 


x: 


D 


M 


u 


CO 









rH 


c 


c 


SZ 


<u 


0) 





d 


en 











u 


u 


U 


T3 


T3 


T3 


>i 


>i 


>i 


B 


s 


S 



o 

>1 



0) 

c 

•H 

E 
rrj 

iH 

>i 

5 

0) 

s 



0) 
•H 

£ 
o 

H 
CQ 



>i 

J3 

0) 

a 



in 



in 



in 



c 

•H 
U 
O 

H 







cr 








•H 








a 






0) 








-P 


c 






d 


•H 




CD 


IW 


M 


0) 


c 


rH 


T3 


M 


•H 


3 


>i 


a 


E 


W 


.C 


E 


id 




f0 


•iH 


rH 


r-i 


H 


a) 


>i 


>1 





c 


.C 


,C 


H 


a> 


■P 


-P 


£ 


rH 


CD 


O 





>1 


E 


E 


•H 


A 


•H 


•H 


£L 


■P 


Q 


Q 


H 


w 



0) 
<0 
•H 

X 

o 

0) 

c 
a 
t-\ 
>i 

J3 
P 
H 



-219- 



4-1 

u 

Q 



z 



Z 



Z 



z 



vo 



•H 
S-l 

o 

H 

s: 
u 



•P 

s 



0) 






T3 






•H 






X 









0) 




n 


T3 


'O 


4J 


•H 


•H 


<D 


K 





M 



•H 


< 


C 


O 


O --. 


d) 




•H C7> 


tr> 


u 


u c 





3 


P-H 


u 


«4H 


4-1 g 


4J 


rH 


rH 3 


•H 


3 


3 fa 


Z 


w 


W — ' 



<d 
1-3 

to 
o 

•H 
(0 

•o 

0) 
•H 
rH 

Ou 

a- 



■p 

•H 
XO 

u 

I 

•H 

C 

D 

w 

c 

•H 

a, 
o 

S3 

to 

c 

o 

C 
•> «J 

0) rH 
T3 >i 
•H H 

3 fO 
U S 

0) * 

W rH 
C 0) 
O M 

a 3 

tQ (TJ 

0) i-3 

o r-» 

C ^ 

H r-l 



e 
w 



0) 



a) 
+j 



-220- 



APPENDIX G 



Alternative: 
Date: 



WORKSHEET 4: 
POPULATION RISK CALCULATIONS FOR 

THE FOUR ALTERNATIVE ROUTES IN 
THE WASHINGTON, D. C. , CASE STUDY 



WORKSHEET 4: POPULATION RISK CALCULATIONS 



H.M. fl u rFlammable L iquid 



Page_L.of.L_ 
i 


2 






3 


4 




Impact RaiBuir .5 mile 
5 6 


SEGMENT 


f (ANT VEHICU ACQ 


1 

> 


/ HJL accident J 
v inaoEMCc fktoi ~ 


Z P(HJl VOL ACCJ 


1 
> 


/ SEGMENT J 
> WPUUTIOII — 


se.ment 
z mruiAnoti 


1-A 


7.680 x 10" 6 


13 1 10 •* 


1.766 x 10" 10 


8436 


1.490 x 10~ 6 


1-B 


1.971 x 10~ 6 


if 


4.533 x 10" 11 


• 9047 


4.101 x 10" 7 


1-C 


4.986 x 10" 6 


»! 


1.147 x 10" 10 


1023 


1.173 x 10~ 7 


1-D 


9.185 x 10~ 6 


it 


2.113 x 10~ 10 


22078 


4.664 x 10~ 6 


1-E 


12.084 x 10~ 6 


II 


2.779 x 10~ 10 


20291 


5.640 x 10~ 6 






»• 




TOTAL 




1.232 x 10 _:> 






n 












I! 












II 












II 












II 












II 












1 1 












II 












II 












11 












11 












11 












11 












11 












11 












11 












11 


' 










It 










U 1 10 -s 









-221- 



Alternative. 



Date. 



WORKSHEET 4: POPULATION RISK CALCULATIONS 



H.M. Ch 



Pagei_ofl 

l 


2 


3 


4 


S 


6 


SEGMENT 


1 

r(Anr vehicu agcj y 


y tULMaDENT J 
S INCIDENCE FKTOI ~ 


"1 
Z P(H.M. VEH. ACCJ / 


/ SEGMEHT J 

>■ rapuunoH — 


SEEMENT 

- raniunoN 

USX 


2-A 


7.680 x 10" 6 


U 1 10 -5 


1.766 x 10~ 10 


8436 


1.490 x 10" 6 


2-B 


1.971 x 10~ 6 


If 


4.533 x 10~ U 


9047 


4.101 x 10" 7 


2-C 


4.986 x 10" 6 


»J 


1.147 x 10" 10 


1023 


1.173 x 10~ 7 


2-D 


5.146 x 10" 6 


1* 


1.184 x 10" 10 


5>90 


6.619 x 10~ 7 


2-E 


3.798 x 10" 6 


II 


8.735 x 10~ U 


6937 


6.060 x 10~ 7 


2-F 


9.204 x 10" 6 


»• 


2.117 x 10" 10 


27726 


5.870 x 10~ 6 


2-G 


2.808 x 10~ 6 


II 


6.458 x 10 -11 


2788 


1.801 x 10~ 7 


2-H 


7.889 x 10~ 6 


If 


1.815 x 10~ 10 


9699 


1.760 x 10~ 6 


2-1 


8.892 x 10~ 6 


II 


2.045 x 10" 10 


9837 


2.021 x 10~ 6 






•« 




TOTAL 


1.311 x 10 -5 






!« 












11 












II 










. 


11 












If 












11 












11 












11 












11 












11 












11 












II 












11 












11 












UiW s 









-222- 



«- -i 



Alternative:. 



Date: 



WORKSHEET 4: POPULATION RISK CALCULATIONS 



PageJLofJ 
i 



H.M. <W Finable Liquid 

Impact Radius: .5 mile 
5 6 



SEGMENT 


1 

P|ANT VEHICLE ACt) )* 


/ UK. ACCIDENT J 
V INCIDENCE FACTOR ~ 


1 

Z PSUL VEH. ACt) > 


/ SE6MENT J 
^ WULATKffl - 


SEGMENT 

r raruumoN 

Ittt 


3-A 


4.773 x 10~ 6 


13 1 10 -5 


1.098 x 10~ 10 


4994 


5.482 x 10" 7 


3-B 


5.385 x 10~ 6 


it 


1.239 x 10~ 10 


16614 


2.059 x 10" 6 


3-C 


5.493 x 10~ 6 


>t 


1.263 x 10~ 10 


18340 


2.317 x 10~ 6 


3-D 


3.996 x 10~ 6 


*• 


9.191 x 10~ U 


3328 


3.059 x 10" 7 


3-E 


6.204 x 10" 6 


ii 


1.427 x 10" 10 


16773 


2.394 x 10" 6 


3-F 


1.984 x 10~ 6 


»» 


4.563 x 10~ U 


4791 


2.186 x 10 -7 


3-G 


9.204 x 10" 6 


ii 


2.117 x 10" 10 


27726 


5.870 x 10" 6 


3-H 


2.808 x 10" 6 


M 


6.458 x 10~ U 


2788 


1.801 x 10" 7 


3-1 


7.889 x 10~ 6 


li 


1.815 x 10" 10 


9689 


1.760 x 10 -6 


3-J 


8.892 x 10" 6 


it 


2.045 x 10" 10 


9837 


2.012 x 10~ 6 






it 




TOTAL 


1.767 x 10~ 5 






it 












ti . 












it 












tt 












tt 












tt 












it 












it 












it 












it 












•• 












tt 












ii 












13 1 10 - J 









-223- 



Alternative. 



Date. 



WORKSHEET 4: POPULATION RISK CALCULATIONS 



PinXof_L 



H.M. ctosElamafclfl Liquid 

Impact Radius; .5 mile 



1 


2 






3 


* 


5 


6 


SEGMENT 


why vehicle acq 


> 


/ hjl accident J 

•v INCIOENCE FKTOI ~ 


"1 
Z P(HJL YEH. ACCJ y 


• SEGMENT J 
> rOPUUTION - 


SEGMENT 

- wfuution 
iisk 


4-A 


4.773 x 10" 6 


13 1 11 -S 


1.098 x 10~ 10 


4994 


5.482 x 10" 7 


4-B 


5.385 x 10~ 6 


if 


1.239 x 10~ 10 


16614 


2.058 x 10" 6 


4-C 


5.493 x 10" 6 


IJ 


1.263 x 10~ 10 


18340 


2.317 x 10" 6 


4-D 


3.996 x 10~ 6 


11 


9.191 x 10" 11 


3328 


3.059 x 10" 7 


4-E 


5.724 x 10" 6 


it 


1.317 x 10" 10 


19895 


2.619 x 10" 6 


4-F 


7.812 x 10~ 6 


»• 


1.797 x 10" 10 


15221V 1 " 


2.735 x 10~ 6 


4-G 


10.604 x 10~ 6 


•1 


2.439 x 10* 10 


15667 


3.821 x 10" 6 


4-H 


3.773 x 10~ 6 


If 


8.678 x 10" 11 


2980 


2.586 x 10~ 7 


4-1 


7.889 x 10~ 6 


if 


1.815 x 10" 10 


9689 


1.759 x 10" 6 


4-J 


8.892 x 10" 6 


tf 


2.045 x 10" 10 


9837 


2.012 x 10" 6 






i« 




TOTAL 


1.843 x 10~ 5 






if 














ft 












if 












• t 












ti 












if 












ti 












ti 












it 












ii 












it 












ii 












ti 












13iW s 









-224- 



APPENDIX H 
STATISTICAL DESCRIPTORS FOR PREDICTIVE EQUATIONS 



INTERSTATE MODEL (27) 





CORRELATION COEFFICIENT 


CONFIDENCE LEVEL 




ROADWAY TYPE 


(Accident Rate vs. AADT) 


FOR POPULATION r(f>)* 








(%) 






I 






Rural/Suburban 








4 - Lane 


.210 


99 




6 - Lane 


.467 


99 




8 - Lane 


.552 


99 




Urban 








4 - Lane 


.381 


99 




6 - Lane 


.300 


99 




8 - Lane 


.296 


99 




10 - Lane 


.591 


99 





* Level of confidence at whiclid is (statistically) significantly different 



from zero. 



Figure H-l on the following page presents plots for the regression equations. 



-225- 






W 


o 


>1 




< 






o 


w 




Pi 


.'V 


!3 


♦ 


O 




w 


° ? 


w 


2 S 


H 


S 


d 


h- 




O _ 




N £ 


H 


• 


55 


_ u. 


W 


o < 


M 


t- 


O 


> 


O 


_j 


<3 


O < 




o o 
taj 
O 


4 


< 
O hi 


H 
O 


• > 

< 


H 


e 


• • 


• 


iH 




1 


o 




k 


3 




J3 


o 


O 


• 


H 




P»4 



• •MM »I»IM»A uoniin Jtd *3X*M 1N3QI33V 1VJ.01 



-226- 






URBAN ARTERIALS (30) 

One hundred sections of urban arterials, which varied in length 
from 01254 to 4.167 miles, were used to calibrate the regression model. 
The study sections were located in Lafayette and Indianapolis, Indiana. 
Most of the study sections were urban extensions of state highways be- 
cause of the availability of volume and accident data for them. 

In two separate analyses, two different dependent variables were 
regressed against the independent variables of volume (AADT) , the number 
of heavy volume intersections per mile, and the number of traffic signals 
per mile. The first dependent variable, number of accidents per 100 
million vehicle-miles, failed to produce an equation that could explain 
more than 50 percent of the variability in accident rates on these sec- 
tions. Regressing the independent variable against the accident rate 
also produced illogical and contradictory results. 

The regression equation for annual accidents per mile, on the other hand, 
explained 74 percent of the variability in the number of accidents on the 
study sections (R = .74). In addition, the signs of the coefficients are posi- 
tive and support the notion that more traffic interactions (e.g., intersections) 
result in more accidents. 



LANE CONVENTIONAL RURAL HIGHWAYS (27) 



Equation 


MVM 
In Sample 


Number of 
Segments 


Standard Error 
of Estimate 
for the Regression 


Correlation 

Coefficient 

(Accident Rates 

vs. AADT) 


Confidence Level* 
for Population r(p) 


** 
Y=1.87+0.65/x 


901 


41 


.94 


.372 


98% 



* Level of confidence at which O is (statistically) significantly different from zero. 
** Equation for a rolling, 2 - Lane Rural Highway with speeds > 55 mph. 



Figure H-2 on the following page presents plots for the regression equations. 



-227- 



1 1 'ili! 'H** 




Figure 1 



C/3 

<5 



H 



I 

o 

M 
H 

W 



o 



<N 



It 


S3 


to u. 


O 


- < 




(C 


W 


»- 


w 




H 


>- 
_l 


2 


< 




o 


H 




S 


111 


W 


C9 

< 


Q 


(E 


M 


111 


U 


_ > 


O 


o < 


<5 




3 




H 




O 




H 




• • 




Cvl 




W 




w 




B 




o 




M 




fe 






l^« 



o 
n 

o 



o 
id 



• o o 

cj — 

• »I!W »|3!M»A uoi||!W jad ' 3J.VH 1N3OI00V 1V101 



*U.S. GOVERNMENT PRINTING OFFICE: 1980 722-053/318 1-3 



-228- 













BOOKMARK 


^\ 






DATEDUE:^ A 

i (JCT 4 1993 

TO' 





~--?+r\ 



FEDERALLY COORDINATED PROGRAM (FCP) OF HIGHWAY 
RESEARCH AND DEVELOPMENT 



The Offices of Research and Development (R&D) of 
the Federal Highway Administration (FHWA) are 
responsible for a broad program of staff and contract 
research and development and a Federal-aid 
program, conducted by or through the State highway 
transportation agencies, that includes the Highway 
Planning and Research (HP&R) program and the 
National Cooperative Highway Research Program 
(NCHRP) managed by the Transportation Research 
Board. The FCP is a carefully selected group of proj- 
ects that uses research and development resources to 
obtain timely solutions to urgent national highway 
engineering problems.* 

The diagonal double stripe on the cover of this report 
represents a highway and is color-coded to identify 
the FCP category that the report falls under. A red 
stripe is used for category 1, dark blue for category 2, 
light blue for category 3, brown for category 4, gray 
for category 5, green for categories 6 and 7, and an 
orange stripe identifies category 0. 

FCP Category Descriptions 

1. Improved Highway Design and Operation 
for Safety 

Safety R&D addresses problems associated with 
the responsibilities of the FHWA under the 
Highway Safety Act and includes investigation of 
appropriate design standards, roadside hardware, 
signing, and physical and scientific data for the 
formulation of improved safety regulations. 

2. Reduction of Traffic Congestion, and 
Improved Operational Efficiency 

Traffic R&D is concerned with increasing the 
operational efficiency of existing highways by 
advancing technology, by improving designs for 
existing as well as new facilities, and by balancing 
the demand-capacity relationship through traffic 
management techniques such as bus and carpool 
preferential treatment, motorist information, and 
rerouting of traffic. 

3. Environmental Considerations in Highway 
Design, Location, Construction, and Opera- 
tion 

Environmental R&D is directed toward identify- 
ing and evaluating highway elements that affect 



* The complete seven-volume official statement of the FCP is available from 
the National Technical Information Service, Springfield, Va. 22161. Single 
copies of the introductory volume are available without charge from Program 
Analysis (HRD-3), Offices of Research and Development, Federal Highway 
Administration, Washington, D.C. 20590. 



the quality of the human environment. The goals 
are reduction of adverse highway and traffic 
impacts, and protection and enhancement of the 
environment. 

4. Improved Materials Utilization and 
Durability 

Materials R&D is concerned with expanding the 
knowledge and technology of materials properties, 
using available natural materials, improving struc- 
tural foundation materials, recycling highway 
materials, converting industrial wastes into useful 
highway products, developing extender or 
substitute materials for those in short supply, and 
developing more rapid and reliable testing 
procedures. The goals are lower highway con- 
struction costs and extended maintenance-free 
operation. 

5. Improved Design to Reduce Costs, Extend 
Life Expectancy, and Insure Structural 
Safety 

Structural R&D is concerned with furthering the 7 
latest technological advances in structural and 
hydraulic designs, fabrication processes, and 
construction techniques to provide safe, efficient 
highways at reasonable costs. 

6. Improved Technology for Highway 
Construction 

This category is concerned with the research, 
development, and implementation of highway 
construction technology to increase productivity, 
reduce energy consumption, conserve dwindling 
resources, and reduce costs while improving the 
quality and methods of construction. 

7. Improved Technology for Highway 
Maintenance 

This category addresses problems in preserving 
the Nation's highways and includes activities in 
physical maintenance, traffic services, manage- 
ment, and equipment. The goal is to maximize 
operational efficiency and safety to the traveling 
public while conserving resources. 

0. Other New Studies 

This category, not included in the seven-volume 
official statement of the FCP, is concerned with 
HP&R and NCHRP studies not specifically related 
to FCP projects. These studies involve R&D 
support of other FHWA program office research. 




DOT LIBRARY 




□DDSbT03